Incidental Mutation 'R4003:Triobp'
ID 311361
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 040945-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4003 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78947724-79005869 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 78959977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229943]
AlphaFold Q99KW3
Predicted Effect unknown
Transcript: ENSMUST00000109689
AA Change: D131G
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: D131G

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109690
AA Change: D131G
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: D131G

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140228
AA Change: D131G
Predicted Effect probably benign
Transcript: ENSMUST00000229943
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik T C X: 89,930,510 I694V probably benign Het
9330182L06Rik A C 5: 9,440,877 E629A probably benign Het
Adgrf4 A T 17: 42,669,759 I145N probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Bmp8b T A 4: 123,121,878 probably benign Het
Cdhr2 A T 13: 54,718,266 E293V probably benign Het
Cerkl C A 2: 79,428,794 R33L possibly damaging Het
Chd9 C T 8: 90,956,557 R542C probably damaging Het
Csnk2a1 A G 2: 152,250,575 E22G probably damaging Het
Dnah7c A G 1: 46,681,817 K2834E probably damaging Het
Eftud2 C T 11: 102,860,110 E286K possibly damaging Het
Fam222b C T 11: 78,154,929 P439S probably benign Het
Gm498 A T 7: 143,897,303 M350L probably benign Het
Gsn A G 2: 35,283,983 K35E probably benign Het
Hif3a T A 7: 17,044,919 Q358H probably damaging Het
L3hypdh T C 12: 72,085,116 D14G probably benign Het
Map2 T C 1: 66,415,740 I1263T probably damaging Het
Mrgprx3-ps T C 7: 47,310,211 T11A probably benign Het
Mylk C A 16: 34,963,577 A1371D probably benign Het
Myo1b A G 1: 51,799,530 probably null Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Pkp3 A G 7: 141,088,737 probably null Het
Ptprt A G 2: 161,566,117 probably benign Het
Rabep1 T A 11: 70,917,367 M340K probably benign Het
Scn10a T C 9: 119,608,968 D1945G probably null Het
Slc22a2 A T 17: 12,612,450 I376F probably benign Het
Slc34a1 T C 13: 55,402,661 probably benign Het
Smc2 T C 4: 52,462,897 V629A probably damaging Het
Stab2 G T 10: 86,858,124 D633E probably damaging Het
Tmco3 G A 8: 13,291,959 V78M probably damaging Het
Tnfaip2 C T 12: 111,451,344 probably benign Het
Tnfrsf25 T C 4: 152,119,601 M333T probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp236 A T 18: 82,680,745 C70* probably null Het
Zfp384 T C 6: 125,033,237 probably benign Het
Zfp619 A G 7: 39,537,306 E920G possibly damaging Het
Zhx3 G A 2: 160,780,889 P453S probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8446:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8448:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8469:Triobp UTSW 15 78967019 missense probably benign 0.00
R8491:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8492:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8493:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R9424:Triobp UTSW 15 78960066 missense probably damaging 1.00
R9495:Triobp UTSW 15 78993178 missense probably damaging 1.00
R9514:Triobp UTSW 15 78993178 missense probably damaging 1.00
R9530:Triobp UTSW 15 79002121 missense probably damaging 1.00
R9550:Triobp UTSW 15 78973877 missense probably damaging 1.00
R9576:Triobp UTSW 15 78960066 missense probably damaging 1.00
R9646:Triobp UTSW 15 79003734 missense probably damaging 1.00
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAACACGCCCACATGTAG -3'
(R):5'- GAAAAGCTCAGCCTTCCTCAAG -3'

Sequencing Primer
(F):5'- ACATGTAGTACCCGGGTGG -3'
(R):5'- AAGCTCCTCCTGTCACCAG -3'
Posted On 2015-04-29