Incidental Mutation 'R4003:4930415L06Rik'
ID311368
Institutional Source Beutler Lab
Gene Symbol 4930415L06Rik
Ensembl Gene ENSMUSG00000035387
Gene NameRIKEN cDNA 4930415L06 gene
Synonyms
MMRRC Submission 040945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4003 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location89930098-89932852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89930510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 694 (I694V)
Ref Sequence ENSEMBL: ENSMUSP00000085471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088146]
Predicted Effect probably benign
Transcript: ENSMUST00000088146
AA Change: I694V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085471
Gene: ENSMUSG00000035387
AA Change: I694V

DomainStartEndE-ValueType
SCOP:d1k5db_ 18 107 1e-22 SMART
Pfam:SMK-1 178 369 9e-72 PFAM
low complexity region 650 663 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A C 5: 9,440,877 E629A probably benign Het
Adgrf4 A T 17: 42,669,759 I145N probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Bmp8b T A 4: 123,121,878 probably benign Het
Cdhr2 A T 13: 54,718,266 E293V probably benign Het
Cerkl C A 2: 79,428,794 R33L possibly damaging Het
Chd9 C T 8: 90,956,557 R542C probably damaging Het
Csnk2a1 A G 2: 152,250,575 E22G probably damaging Het
Dnah7c A G 1: 46,681,817 K2834E probably damaging Het
Eftud2 C T 11: 102,860,110 E286K possibly damaging Het
Fam222b C T 11: 78,154,929 P439S probably benign Het
Gm498 A T 7: 143,897,303 M350L probably benign Het
Gsn A G 2: 35,283,983 K35E probably benign Het
Hif3a T A 7: 17,044,919 Q358H probably damaging Het
L3hypdh T C 12: 72,085,116 D14G probably benign Het
Map2 T C 1: 66,415,740 I1263T probably damaging Het
Mrgprx3-ps T C 7: 47,310,211 T11A probably benign Het
Mylk C A 16: 34,963,577 A1371D probably benign Het
Myo1b A G 1: 51,799,530 probably null Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Pkp3 A G 7: 141,088,737 probably null Het
Ptprt A G 2: 161,566,117 probably benign Het
Rabep1 T A 11: 70,917,367 M340K probably benign Het
Scn10a T C 9: 119,608,968 D1945G probably null Het
Slc22a2 A T 17: 12,612,450 I376F probably benign Het
Slc34a1 T C 13: 55,402,661 probably benign Het
Smc2 T C 4: 52,462,897 V629A probably damaging Het
Stab2 G T 10: 86,858,124 D633E probably damaging Het
Tmco3 G A 8: 13,291,959 V78M probably damaging Het
Tnfaip2 C T 12: 111,451,344 probably benign Het
Tnfrsf25 T C 4: 152,119,601 M333T probably damaging Het
Triobp A G 15: 78,959,977 probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp236 A T 18: 82,680,745 C70* probably null Het
Zfp384 T C 6: 125,033,237 probably benign Het
Zfp619 A G 7: 39,537,306 E920G possibly damaging Het
Zhx3 G A 2: 160,780,889 P453S probably damaging Het
Other mutations in 4930415L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:4930415L06Rik APN X 89931523 missense probably benign 0.17
IGL02226:4930415L06Rik APN X 89931912 missense probably damaging 0.99
R1980:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1981:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1982:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R2299:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2381:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R2895:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2896:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R4001:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4042:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4043:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4280:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4281:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4282:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
Z1088:4930415L06Rik UTSW X 89930236 missense unknown
Z1088:4930415L06Rik UTSW X 89930237 missense unknown
Z1176:4930415L06Rik UTSW X 89930241 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGAAGCATCCCCATGAGATG -3'
(R):5'- ACGTCTCTGATTGTAAACATTGTGG -3'

Sequencing Primer
(F):5'- TGGACAACATTCAGAAGCTTCAG -3'
(R):5'- GGGCTTTTAAATCAATTGAGTATGTC -3'
Posted On2015-04-29