Incidental Mutation 'R4004:Fcgr1'
ID311381
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene NameFc receptor, IgG, high affinity I
SynonymsCD64, FcgammaRI
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96282909-96293969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96284352 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 380 (V380A)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
Predicted Effect probably benign
Transcript: ENSMUST00000029748
AA Change: V380A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: V380A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96284370 missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96284577 missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96284498 nonsense probably null
F5770:Fcgr1 UTSW 3 96284276 makesense probably null
FR4737:Fcgr1 UTSW 3 96284504 frame shift probably null
FR4737:Fcgr1 UTSW 3 96287094 missense probably benign 0.01
R0323:Fcgr1 UTSW 3 96285829 missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96292312 missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96292366 missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96285868 missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96285917 missense possibly damaging 0.88
R3941:Fcgr1 UTSW 3 96286033 missense probably benign 0.13
R4409:Fcgr1 UTSW 3 96284577 missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96286986 missense probably damaging 0.99
R5047:Fcgr1 UTSW 3 96285884 missense probably benign 0.38
R6970:Fcgr1 UTSW 3 96284620 critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96284299 missense not run
V7581:Fcgr1 UTSW 3 96284276 makesense probably null
V7582:Fcgr1 UTSW 3 96284276 makesense probably null
V7583:Fcgr1 UTSW 3 96284276 makesense probably null
X0028:Fcgr1 UTSW 3 96286027 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGACCTGACTCCATGTGTTG -3'
(R):5'- TGTGAAAATACACAGGCTGCAG -3'

Sequencing Primer
(F):5'- GACTCCATGTGTTGCAAGATC -3'
(R):5'- TACACAGGCTGCAGAGAGAG -3'
Posted On2015-04-29