Mutagenetix > Incidental Mutations

Incidental Mutation 'R4004:Vcp'

311383

Institutional Source

Beutler Lab

Gene Symbol

Vcp

Ensembl Gene

ENSMUSG00000028452

Gene Name

valosin containing protein

Synonyms

AAA ATPase p97, p97/VCP, p97, CDC48

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42979963-43000507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42983028 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 606 (T606I)

Ref Sequence

ENSEMBL: ENSMUSP00000030164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000139127]

PDB Structure

STRUCTURE OF THE N-TERMINAL DOMAIN AND THE D1 AAA DOMAIN OF MEMBRANE FUSION ATPASE P97 [X-RAY DIFFRACTION]
The crystal structure of murine p97/VCP at 3.6A [X-RAY DIFFRACTION]
Crystal structure of AAA ATPase p97/VCP ND1 in complex with p47 C [X-RAY DIFFRACTION]
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Structure of D2 subdomain of P97/VCP in complex with ADP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/ADP.alfx [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/AMP-PNP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030164
AA Change: T606I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452
AA Change: T606I

Domain	Start	End	E-Value	Type
CDC48_N	25	108	6.85e-27	SMART
CDC48_2	125	191	3.77e-15	SMART
AAA	237	373	7.87e-24	SMART
AAA	510	649	2e-25	SMART
Pfam:Vps4_C	710	762	3.5e-7	PFAM
low complexity region	775	794	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139127

SMART Domains

Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

Domain	Start	End	E-Value	Type
low complexity region	38	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154541

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. Mice homozygous for a knock-in allele exhibit progressive muscle weakness, myopathy, decreased bone density, increased osteoclast genesis, and seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	C	7: 79,100,687	E1735D	probably damaging	Het
Ano2	A	G	6: 126,013,279	R788G	probably damaging	Het
Atg9a	T	C	1: 75,186,451	Y335C	probably damaging	Het
BC067074	A	G	13: 113,318,380	Q320R	probably benign	Het
Capn10	T	A	1: 92,940,591	L260Q	probably damaging	Het
Ces1d	A	T	8: 93,178,092	F340Y	probably benign	Het
Ctbp2	C	A	7: 132,991,773	R733L	probably benign	Het
Dgkd	T	C	1: 87,935,423	I64T	possibly damaging	Het
Dmxl2	T	C	9: 54,446,390	I765V	probably benign	Het
Dync2h1	C	A	9: 7,117,404	C62F	probably damaging	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fcgr1	A	G	3: 96,284,352	V380A	probably benign	Het
Gif	T	G	19: 11,759,007	V314G	probably damaging	Het
Herc2	C	A	7: 56,106,465	P751Q	possibly damaging	Het
Ikzf3	C	T	11: 98,489,017	E142K	probably damaging	Het
Kctd3	A	G	1: 188,992,743	S214P	probably benign	Het
Lrpap1	T	A	5: 35,105,544	K50*	probably null	Het
Naa11	A	T	5: 97,391,793	Y169N	probably benign	Het
Nupl2	T	C	5: 24,182,436	I408T	probably damaging	Het
Olfr366	A	T	2: 37,219,948	H153L	probably benign	Het
Olfr721-ps1	C	T	14: 14,408,152	A308V	probably benign	Het
Plxnc1	G	A	10: 94,794,597	Q1512*	probably null	Het
Ptpn14	A	G	1: 189,850,510	N518S	probably benign	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Ric1	C	T	19: 29,579,801	R429C	probably benign	Het
Rpn2	T	C	2: 157,318,008	L548P	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Slc28a1	T	C	7: 81,169,038	S580P	probably damaging	Het
Slco6c1	A	G	1: 97,075,885	Y496H	probably damaging	Het
Spag5	T	C	11: 78,321,529	M1101T	probably benign	Het
Utp11	A	T	4: 124,682,437	F138I	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp316	A	G	5: 143,255,119	S382P	possibly damaging	Het

Other mutations in Vcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01460:Vcp	APN	4	42996040	missense	possibly damaging	0.69
IGL02251:Vcp	APN	4	42988728	missense	possibly damaging	0.49
H8562:Vcp	UTSW	4	42982596	missense	probably damaging	1.00
R0627:Vcp	UTSW	4	42983011	missense	possibly damaging	0.83
R0639:Vcp	UTSW	4	42982565	missense	probably benign	0.00
R0711:Vcp	UTSW	4	42986201	missense	probably benign	0.22
R0766:Vcp	UTSW	4	42988728	missense	possibly damaging	0.49
R1312:Vcp	UTSW	4	42988728	missense	possibly damaging	0.49
R1702:Vcp	UTSW	4	42990840	missense	probably damaging	1.00
R2071:Vcp	UTSW	4	42995894	critical splice donor site	probably null
R2192:Vcp	UTSW	4	42982547	missense	probably benign
R2262:Vcp	UTSW	4	42980828	missense	probably benign	0.04
R2265:Vcp	UTSW	4	42980833	missense	possibly damaging	0.93
R2268:Vcp	UTSW	4	42980833	missense	possibly damaging	0.93
R2269:Vcp	UTSW	4	42980833	missense	possibly damaging	0.93
R2443:Vcp	UTSW	4	42983385	missense	probably damaging	1.00
R2937:Vcp	UTSW	4	42980846	missense	probably damaging	1.00
R2973:Vcp	UTSW	4	42996315	missense	probably damaging	1.00
R4488:Vcp	UTSW	4	42993826	missense	probably damaging	0.96
R4546:Vcp	UTSW	4	42988813	intron	probably benign
R4578:Vcp	UTSW	4	42984565	missense	probably benign	0.41
R4817:Vcp	UTSW	4	42983486	missense	probably damaging	1.00
R4869:Vcp	UTSW	4	42993691	missense	probably benign	0.00
R5014:Vcp	UTSW	4	42980828	missense	probably benign	0.04
R6128:Vcp	UTSW	4	42980941	missense	probably benign	0.00
R6594:Vcp	UTSW	4	42993826	missense	probably damaging	0.96
R7105:Vcp	UTSW	4	42985991	missense	probably damaging	1.00
R7470:Vcp	UTSW	4	42982891	missense	probably damaging	1.00
R8006:Vcp	UTSW	4	42985993	missense	probably benign	0.04
R8234:Vcp	UTSW	4	42985242	missense	probably damaging	1.00
R8313:Vcp	UTSW	4	42988728	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AAGTTCCTATGGCTGACAACTC -3'
(R):5'- TCTGAAGCCTGAGAAATCTAGTTG -3'

Sequencing Primer
(F):5'- TATGGCTGACAACTCTGCAC -3'
(R):5'- AGCCTGAGAAATCTAGTTGTGTCAGC -3'

Posted On

2015-04-29