Incidental Mutation 'R4004:Vcp'
ID311383
Institutional Source Beutler Lab
Gene Symbol Vcp
Ensembl Gene ENSMUSG00000028452
Gene Namevalosin containing protein
SynonymsAAA ATPase p97, p97/VCP, p97, CDC48
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location42979963-43000507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42983028 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 606 (T606I)
Ref Sequence ENSEMBL: ENSMUSP00000030164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000139127]
PDB Structure
STRUCTURE OF THE N-TERMINAL DOMAIN AND THE D1 AAA DOMAIN OF MEMBRANE FUSION ATPASE P97 [X-RAY DIFFRACTION]
The crystal structure of murine p97/VCP at 3.6A [X-RAY DIFFRACTION]
Crystal structure of AAA ATPase p97/VCP ND1 in complex with p47 C [X-RAY DIFFRACTION]
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Structure of D2 subdomain of P97/VCP in complex with ADP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/ADP.alfx [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/AMP-PNP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030164
AA Change: T606I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452
AA Change: T606I

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154541
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. Mice homozygous for a knock-in allele exhibit progressive muscle weakness, myopathy, decreased bone density, increased osteoclast genesis, and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Vcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Vcp APN 4 42996040 missense possibly damaging 0.69
IGL02251:Vcp APN 4 42988728 missense possibly damaging 0.49
H8562:Vcp UTSW 4 42982596 missense probably damaging 1.00
R0627:Vcp UTSW 4 42983011 missense possibly damaging 0.83
R0639:Vcp UTSW 4 42982565 missense probably benign 0.00
R0711:Vcp UTSW 4 42986201 missense probably benign 0.22
R0766:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1312:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1702:Vcp UTSW 4 42990840 missense probably damaging 1.00
R2071:Vcp UTSW 4 42995894 critical splice donor site probably null
R2192:Vcp UTSW 4 42982547 missense probably benign
R2262:Vcp UTSW 4 42980828 missense probably benign 0.04
R2265:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2268:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2269:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2443:Vcp UTSW 4 42983385 missense probably damaging 1.00
R2937:Vcp UTSW 4 42980846 missense probably damaging 1.00
R2973:Vcp UTSW 4 42996315 missense probably damaging 1.00
R4488:Vcp UTSW 4 42993826 missense probably damaging 0.96
R4546:Vcp UTSW 4 42988813 intron probably benign
R4578:Vcp UTSW 4 42984565 missense probably benign 0.41
R4817:Vcp UTSW 4 42983486 missense probably damaging 1.00
R4869:Vcp UTSW 4 42993691 missense probably benign 0.00
R5014:Vcp UTSW 4 42980828 missense probably benign 0.04
R6128:Vcp UTSW 4 42980941 missense probably benign 0.00
R6594:Vcp UTSW 4 42993826 missense probably damaging 0.96
R7105:Vcp UTSW 4 42985991 missense probably damaging 1.00
R7470:Vcp UTSW 4 42982891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCCTATGGCTGACAACTC -3'
(R):5'- TCTGAAGCCTGAGAAATCTAGTTG -3'

Sequencing Primer
(F):5'- TATGGCTGACAACTCTGCAC -3'
(R):5'- AGCCTGAGAAATCTAGTTGTGTCAGC -3'
Posted On2015-04-29