Incidental Mutation 'R4004:Naa11'
ID311387
Institutional Source Beutler Lab
Gene Symbol Naa11
Ensembl Gene ENSMUSG00000046000
Gene NameN(alpha)-acetyltransferase 11, NatA catalytic subunit
SynonymsArd1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location97382198-97392379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97391793 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 169 (Y169N)
Ref Sequence ENSEMBL: ENSMUSP00000057336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060265]
Predicted Effect probably benign
Transcript: ENSMUST00000060265
AA Change: Y169N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057336
Gene: ENSMUSG00000046000
AA Change: Y169N

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 2.7e-8 PFAM
Pfam:Acetyltransf_7 40 129 1.5e-9 PFAM
Pfam:Acetyltransf_1 46 129 1.4e-18 PFAM
Pfam:FR47 56 137 1.1e-9 PFAM
low complexity region 195 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181724
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Naa11
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4469001:Naa11 UTSW 5 97391626 critical splice donor site probably null
R2567:Naa11 UTSW 5 97391759 missense probably benign
R3686:Naa11 UTSW 5 97391789 missense probably benign 0.00
R6268:Naa11 UTSW 5 97392210 missense probably damaging 1.00
R7687:Naa11 UTSW 5 97391789 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAAGCTATGACTCAAAGGGG -3'
(R):5'- AGAACTTCGGCGCCAAGTAC -3'

Sequencing Primer
(F):5'- GCTATGACTCAAAGGGGTACAG -3'
(R):5'- CAAGTACGTGTCCCTGCAC -3'
Posted On2015-04-29