Incidental Mutation 'R4004:Zfp316'
ID311388
Institutional Source Beutler Lab
Gene Symbol Zfp316
Ensembl Gene ENSMUSG00000046658
Gene Namezinc finger protein 316
SynonymsEmzf1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143249697-143270022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143255119 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 382 (S382P)
Ref Sequence ENSEMBL: ENSMUSP00000125416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051665] [ENSMUST00000161448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051665
AA Change: S382P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059418
Gene: ENSMUSG00000046658
AA Change: S382P

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161448
AA Change: S382P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658
AA Change: S382P

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197349
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Zfp316
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Zfp316 APN 5 143254426 missense probably benign 0.00
IGL01783:Zfp316 APN 5 143262876 missense unknown
R0415:Zfp316 UTSW 5 143264491 missense unknown
R0423:Zfp316 UTSW 5 143253238 missense probably damaging 0.98
R1576:Zfp316 UTSW 5 143264094 missense unknown
R1579:Zfp316 UTSW 5 143253562 missense probably damaging 0.97
R1836:Zfp316 UTSW 5 143253423 missense probably damaging 1.00
R2058:Zfp316 UTSW 5 143263406 missense unknown
R4198:Zfp316 UTSW 5 143254471 missense probably benign 0.05
R4436:Zfp316 UTSW 5 143254048 missense probably damaging 1.00
R4961:Zfp316 UTSW 5 143253414 missense probably damaging 0.98
R5579:Zfp316 UTSW 5 143264491 missense unknown
R5642:Zfp316 UTSW 5 143264091 missense unknown
R5701:Zfp316 UTSW 5 143254377 missense probably benign 0.08
R5795:Zfp316 UTSW 5 143262839 missense unknown
R5861:Zfp316 UTSW 5 143263340 missense unknown
R5965:Zfp316 UTSW 5 143264672 unclassified probably null
R6414:Zfp316 UTSW 5 143254884 missense possibly damaging 0.71
R6547:Zfp316 UTSW 5 143254197 missense probably damaging 1.00
R6922:Zfp316 UTSW 5 143253525 missense probably damaging 0.98
R7002:Zfp316 UTSW 5 143263355 missense unknown
R7361:Zfp316 UTSW 5 143254675 missense probably benign 0.01
R7414:Zfp316 UTSW 5 143264652 missense unknown
R7693:Zfp316 UTSW 5 143263412 missense unknown
X0022:Zfp316 UTSW 5 143255056 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCAGTGTAGACATGGGTAG -3'
(R):5'- AGAACTTTCTGGTGCCCTGG -3'

Sequencing Primer
(F):5'- TAGACATGGGTAGGGCCTCTC -3'
(R):5'- GGCATTTCCCGCAGTGG -3'
Posted On2015-04-29