Incidental Mutation 'R4004:Ano2'
ID311389
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Nameanoctamin 2
SynonymsTmem16b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125690419-126040126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126013279 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 788 (R788G)
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159984] [ENSMUST00000160496]
Predicted Effect probably benign
Transcript: ENSMUST00000159984
SMART Domains Protein: ENSMUSP00000123965
Gene: ENSMUSG00000038115

DomainStartEndE-ValueType
Pfam:Anoctamin 21 181 1.7e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160496
AA Change: R788G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115
AA Change: R788G

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161619
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 126013253 missense probably damaging 1.00
IGL01387:Ano2 APN 6 126013277 missense probably damaging 0.99
IGL01772:Ano2 APN 6 126036858 missense probably damaging 0.98
IGL01931:Ano2 APN 6 125982745 missense probably damaging 1.00
IGL02066:Ano2 APN 6 125690739 missense probably benign 0.07
IGL02410:Ano2 APN 6 125815533 critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125872751 critical splice donor site probably null
IGL03116:Ano2 APN 6 125980171 nonsense probably null
IGL03183:Ano2 APN 6 125710629 missense probably benign
IGL03391:Ano2 APN 6 125807839 missense probably damaging 1.00
R0257:Ano2 UTSW 6 125880713 missense probably benign 0.05
R0462:Ano2 UTSW 6 125712275 missense probably benign 0.26
R0594:Ano2 UTSW 6 125982765 missense probably damaging 1.00
R1072:Ano2 UTSW 6 126039324 missense probably damaging 1.00
R1099:Ano2 UTSW 6 125807847 missense probably damaging 1.00
R1436:Ano2 UTSW 6 125867171 critical splice donor site probably null
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1822:Ano2 UTSW 6 125863457 missense probably damaging 1.00
R1901:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1902:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1911:Ano2 UTSW 6 126013691 missense probably benign 0.00
R2040:Ano2 UTSW 6 126039508 missense probably benign 0.13
R2192:Ano2 UTSW 6 126015539 missense probably damaging 1.00
R2307:Ano2 UTSW 6 125992886 missense probably benign 0.00
R2698:Ano2 UTSW 6 125712346 missense probably benign 0.01
R2878:Ano2 UTSW 6 125863518 missense probably damaging 1.00
R3151:Ano2 UTSW 6 126013317 splice site probably null
R4664:Ano2 UTSW 6 125863538 missense probably benign 0.07
R4684:Ano2 UTSW 6 125790341 missense probably benign 0.00
R4685:Ano2 UTSW 6 125980124 nonsense probably null
R4686:Ano2 UTSW 6 125790291 missense probably benign 0.10
R4852:Ano2 UTSW 6 125982923 missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125903055 utr 3 prime probably benign
R5488:Ano2 UTSW 6 126039253 missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126039322 missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125872740 missense probably damaging 1.00
R5876:Ano2 UTSW 6 126039279 missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125992955 missense probably benign 0.15
R6219:Ano2 UTSW 6 125815590 missense probably damaging 1.00
R6613:Ano2 UTSW 6 125806656 splice site probably null
R6711:Ano2 UTSW 6 125775832 missense probably damaging 1.00
R6982:Ano2 UTSW 6 125992893 missense probably benign
R7153:Ano2 UTSW 6 125992943 missense possibly damaging 0.73
R7182:Ano2 UTSW 6 125790293 missense probably damaging 0.99
R7312:Ano2 UTSW 6 126039497 nonsense probably null
R7358:Ano2 UTSW 6 125710733 missense probably benign
R7456:Ano2 UTSW 6 125963545 missense probably benign 0.01
R7532:Ano2 UTSW 6 125963704 missense probably damaging 1.00
R7607:Ano2 UTSW 6 125712419 missense probably damaging 1.00
R7623:Ano2 UTSW 6 126015573 nonsense probably null
R7690:Ano2 UTSW 6 126013198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGGATGGGCTTTGCTCC -3'
(R):5'- GGGGTAGTTAAATGACTTCCACTG -3'

Sequencing Primer
(F):5'- TCCAGTTTGGTTTTGTCAC -3'
(R):5'- TGGCCTTCCCACATCCAAGG -3'
Posted On2015-04-29