Incidental Mutation 'R4004:Acan'
ID311391
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 79100687 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1735 (E1735D)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably damaging
Transcript: ENSMUST00000032835
AA Change: E1735D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: E1735D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206779
AA Change: E312D
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCAGAGTTAGTGGAGGGTG -3'
(R):5'- GATTCTCCACTCACTTCCGGAG -3'

Sequencing Primer
(F):5'- GGTGTGACTGAACCCACTGTTTC -3'
(R):5'- CTTCCTGAAAGGTCCATGGG -3'
Posted On2015-04-29