Incidental Mutation 'R4004:Plxnc1'
ID311400
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 94794597 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1512 (Q1512*)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020212] [ENSMUST00000099337]
Predicted Effect probably benign
Transcript: ENSMUST00000020212
SMART Domains Protein: ENSMUSP00000020212
Gene: ENSMUSG00000020024

DomainStartEndE-ValueType
coiled coil region 31 100 N/A INTRINSIC
coiled coil region 121 602 N/A INTRINSIC
coiled coil region 656 689 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099337
AA Change: Q1512*
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: Q1512*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTACCCAATTCCTTGTGGTGGG -3'
(R):5'- CCGTGACTTTATGCTTCGTG -3'

Sequencing Primer
(F):5'- TGGGCTCGTGGGCTAAAC -3'
(R):5'- ACTTTATGCTTCGTGTGGCTG -3'
Posted On2015-04-29