Incidental Mutation 'R4004:Ikzf3'
ID311402
Institutional Source Beutler Lab
Gene Symbol Ikzf3
Ensembl Gene ENSMUSG00000018168
Gene NameIKAROS family zinc finger 3
SynonymsZfpn1a3, Aiolos, 5830411O07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98464902-98546031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98489017 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 142 (E142K)
Ref Sequence ENSEMBL: ENSMUSP00000099430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103141]
Predicted Effect probably damaging
Transcript: ENSMUST00000103141
AA Change: E142K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: E142K

DomainStartEndE-ValueType
ZnF_C2H2 117 139 4.34e0 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 4.47e-3 SMART
ZnF_C2H2 201 221 7.11e0 SMART
ZnF_C2H2 450 472 7.11e0 SMART
ZnF_C2H2 478 502 1.64e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140876
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Ikzf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Ikzf3 APN 11 98488857 missense probably damaging 1.00
IGL01537:Ikzf3 APN 11 98516892 missense probably damaging 1.00
IGL03376:Ikzf3 APN 11 98488953 missense probably damaging 1.00
R0030:Ikzf3 UTSW 11 98467612 missense probably benign 0.01
R0266:Ikzf3 UTSW 11 98467317 missense probably benign
R1302:Ikzf3 UTSW 11 98516920 missense probably benign
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1500:Ikzf3 UTSW 11 98518695 missense probably benign 0.16
R1531:Ikzf3 UTSW 11 98490446 missense probably damaging 0.98
R1599:Ikzf3 UTSW 11 98467093 missense probably damaging 1.00
R1623:Ikzf3 UTSW 11 98490331 critical splice donor site probably null
R2154:Ikzf3 UTSW 11 98485649 nonsense probably null
R3915:Ikzf3 UTSW 11 98490586 missense probably damaging 1.00
R4005:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4075:Ikzf3 UTSW 11 98467643 nonsense probably null
R4210:Ikzf3 UTSW 11 98490487 missense probably benign 0.00
R4804:Ikzf3 UTSW 11 98490574 missense probably benign 0.20
R5107:Ikzf3 UTSW 11 98490476 missense probably damaging 1.00
R5266:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5267:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5450:Ikzf3 UTSW 11 98467086 missense probably damaging 1.00
R6237:Ikzf3 UTSW 11 98467053 missense probably damaging 1.00
R6557:Ikzf3 UTSW 11 98516881 missense probably benign
R7832:Ikzf3 UTSW 11 98518699 missense probably benign
R7915:Ikzf3 UTSW 11 98518699 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGTCCATGTCCTCAC -3'
(R):5'- AGCTAGAATTGCTGGTCTGAG -3'

Sequencing Primer
(F):5'- CTCACTTACCAGAATGTGTCCTAAGG -3'
(R):5'- TTCTTCACGGAGGAAGCTCC -3'
Posted On2015-04-29