Mutagenetix > Incidental Mutations

Incidental Mutation 'R4004:Rapgef5'

311403

Institutional Source

Beutler Lab

Gene Symbol

Rapgef5

Ensembl Gene

ENSMUSG00000041992

Gene Name

Rap guanine nucleotide exchange factor (GEF) 5

Synonyms

D030051B22Rik, mr-gef

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117516479-117759737 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117748397 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 740 (I740V)

Ref Sequence

ENSEMBL: ENSMUSP00000105313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109691
AA Change: I740V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: I740V

Domain	Start	End	E-Value	Type
DEP	44	118	2.07e-12	SMART
RasGEFN	300	434	3.12e-34	SMART
Blast:RasGEF	441	502	7e-31	BLAST
RasGEF	574	814	1.52e-100	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000222105
AA Change: I538V

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222185
AA Change: I506V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	C	7: 79,100,687	E1735D	probably damaging	Het
Ano2	A	G	6: 126,013,279	R788G	probably damaging	Het
Atg9a	T	C	1: 75,186,451	Y335C	probably damaging	Het
BC067074	A	G	13: 113,318,380	Q320R	probably benign	Het
Capn10	T	A	1: 92,940,591	L260Q	probably damaging	Het
Ces1d	A	T	8: 93,178,092	F340Y	probably benign	Het
Ctbp2	C	A	7: 132,991,773	R733L	probably benign	Het
Dgkd	T	C	1: 87,935,423	I64T	possibly damaging	Het
Dmxl2	T	C	9: 54,446,390	I765V	probably benign	Het
Dync2h1	C	A	9: 7,117,404	C62F	probably damaging	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fcgr1	A	G	3: 96,284,352	V380A	probably benign	Het
Gif	T	G	19: 11,759,007	V314G	probably damaging	Het
Herc2	C	A	7: 56,106,465	P751Q	possibly damaging	Het
Ikzf3	C	T	11: 98,489,017	E142K	probably damaging	Het
Kctd3	A	G	1: 188,992,743	S214P	probably benign	Het
Lrpap1	T	A	5: 35,105,544	K50*	probably null	Het
Naa11	A	T	5: 97,391,793	Y169N	probably benign	Het
Nupl2	T	C	5: 24,182,436	I408T	probably damaging	Het
Olfr366	A	T	2: 37,219,948	H153L	probably benign	Het
Olfr721-ps1	C	T	14: 14,408,152	A308V	probably benign	Het
Plxnc1	G	A	10: 94,794,597	Q1512*	probably null	Het
Ptpn14	A	G	1: 189,850,510	N518S	probably benign	Het
Ric1	C	T	19: 29,579,801	R429C	probably benign	Het
Rpn2	T	C	2: 157,318,008	L548P	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Slc28a1	T	C	7: 81,169,038	S580P	probably damaging	Het
Slco6c1	A	G	1: 97,075,885	Y496H	probably damaging	Het
Spag5	T	C	11: 78,321,529	M1101T	probably benign	Het
Utp11	A	T	4: 124,682,437	F138I	probably damaging	Het
Vcp	G	A	4: 42,983,028	T606I	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp316	A	G	5: 143,255,119	S382P	possibly damaging	Het

Other mutations in Rapgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Rapgef5	APN	12	117714182	missense	probably damaging	0.99
IGL01405:Rapgef5	APN	12	117721380	missense	probably benign	0.16
IGL01611:Rapgef5	APN	12	117753419	splice site	probably benign
IGL01720:Rapgef5	APN	12	117613435	splice site	probably benign
IGL01958:Rapgef5	APN	12	117730651	missense	probably benign	0.24
IGL02093:Rapgef5	APN	12	117719132	missense	probably damaging	0.98
IGL03210:Rapgef5	APN	12	117742872	missense	probably damaging	1.00
IGL03370:Rapgef5	APN	12	117730559	missense	probably damaging	1.00
IGL03397:Rapgef5	APN	12	117748441	missense	probably damaging	1.00
R0026:Rapgef5	UTSW	12	117689161	missense	probably benign	0.11
R0026:Rapgef5	UTSW	12	117689161	missense	probably benign	0.11
R0100:Rapgef5	UTSW	12	117721299	missense	probably benign	0.05
R0173:Rapgef5	UTSW	12	117688676	missense	probably benign	0.00
R0834:Rapgef5	UTSW	12	117647121	splice site	probably benign
R1331:Rapgef5	UTSW	12	117721349	missense	probably benign	0.04
R1505:Rapgef5	UTSW	12	117688619	missense	possibly damaging	0.92
R1546:Rapgef5	UTSW	12	117647101	missense	probably benign	0.00
R1577:Rapgef5	UTSW	12	117595291	missense	probably benign	0.28
R1597:Rapgef5	UTSW	12	117658320	missense	probably damaging	1.00
R1824:Rapgef5	UTSW	12	117688684	critical splice donor site	probably null
R2065:Rapgef5	UTSW	12	117584119	nonsense	probably null
R2117:Rapgef5	UTSW	12	117714064	intron	probably null
R2169:Rapgef5	UTSW	12	117715395	missense	probably benign	0.25
R2903:Rapgef5	UTSW	12	117714119	missense	probably damaging	1.00
R3983:Rapgef5	UTSW	12	117728670	missense	possibly damaging	0.49
R4652:Rapgef5	UTSW	12	117714128	missense	probably damaging	0.99
R4830:Rapgef5	UTSW	12	117756074	missense	probably damaging	1.00
R5282:Rapgef5	UTSW	12	117739644	missense	probably damaging	1.00
R5348:Rapgef5	UTSW	12	117688611	missense	probably benign	0.24
R5456:Rapgef5	UTSW	12	117728646	splice site	probably null
R5502:Rapgef5	UTSW	12	117721329	missense	probably damaging	1.00
R5741:Rapgef5	UTSW	12	117756029	missense	probably damaging	0.99
R5771:Rapgef5	UTSW	12	117721326	missense	probably benign	0.45
R5905:Rapgef5	UTSW	12	117748426	missense	probably damaging	1.00
R5941:Rapgef5	UTSW	12	117728738	missense	probably damaging	1.00
R6228:Rapgef5	UTSW	12	117721663	intron	probably null
R6233:Rapgef5	UTSW	12	117739718	critical splice donor site	probably null
R6376:Rapgef5	UTSW	12	117721253	missense	probably damaging	1.00
R6475:Rapgef5	UTSW	12	117718207	missense	probably damaging	1.00
R7063:Rapgef5	UTSW	12	117689129	missense	possibly damaging	0.91
R7410:Rapgef5	UTSW	12	117721328	missense	probably damaging	1.00
R7445:Rapgef5	UTSW	12	117755969	missense	probably benign	0.00
R7690:Rapgef5	UTSW	12	117721370	missense	possibly damaging	0.72
R7707:Rapgef5	UTSW	12	117715344	missense	probably damaging	1.00
R7815:Rapgef5	UTSW	12	117755967	missense	probably benign	0.10
X0018:Rapgef5	UTSW	12	117718215	missense	probably damaging	1.00
Z1176:Rapgef5	UTSW	12	117595288
Z1177:Rapgef5	UTSW	12	117688997

Predicted Primers

PCR Primer
(F):5'- AAGGAAGTCTATTCTGCCCAC -3'
(R):5'- CTGTTCCATATGCCCAAAGAGACC -3'

Sequencing Primer
(F):5'- CCTTGTCAAATATGTGGCA -3'
(R):5'- CCTGGGAGTTACTCTGTGTACAAC -3'

Posted On

2015-04-29