Incidental Mutation 'R4004:Rapgef5'
ID311403
Institutional Source Beutler Lab
Gene Symbol Rapgef5
Ensembl Gene ENSMUSG00000041992
Gene NameRap guanine nucleotide exchange factor (GEF) 5
SynonymsD030051B22Rik, mr-gef
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location117516479-117759737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117748397 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 740 (I740V)
Ref Sequence ENSEMBL: ENSMUSP00000105313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]
Predicted Effect probably damaging
Transcript: ENSMUST00000109691
AA Change: I740V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: I740V

DomainStartEndE-ValueType
DEP 44 118 2.07e-12 SMART
RasGEFN 300 434 3.12e-34 SMART
Blast:RasGEF 441 502 7e-31 BLAST
RasGEF 574 814 1.52e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222105
AA Change: I538V

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000222185
AA Change: I506V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Rapgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Rapgef5 APN 12 117714182 missense probably damaging 0.99
IGL01405:Rapgef5 APN 12 117721380 missense probably benign 0.16
IGL01611:Rapgef5 APN 12 117753419 splice site probably benign
IGL01720:Rapgef5 APN 12 117613435 splice site probably benign
IGL01958:Rapgef5 APN 12 117730651 missense probably benign 0.24
IGL02093:Rapgef5 APN 12 117719132 missense probably damaging 0.98
IGL03210:Rapgef5 APN 12 117742872 missense probably damaging 1.00
IGL03370:Rapgef5 APN 12 117730559 missense probably damaging 1.00
IGL03397:Rapgef5 APN 12 117748441 missense probably damaging 1.00
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0100:Rapgef5 UTSW 12 117721299 missense probably benign 0.05
R0173:Rapgef5 UTSW 12 117688676 missense probably benign 0.00
R0834:Rapgef5 UTSW 12 117647121 splice site probably benign
R1331:Rapgef5 UTSW 12 117721349 missense probably benign 0.04
R1505:Rapgef5 UTSW 12 117688619 missense possibly damaging 0.92
R1546:Rapgef5 UTSW 12 117647101 missense probably benign 0.00
R1577:Rapgef5 UTSW 12 117595291 missense probably benign 0.28
R1597:Rapgef5 UTSW 12 117658320 missense probably damaging 1.00
R1824:Rapgef5 UTSW 12 117688684 critical splice donor site probably null
R2065:Rapgef5 UTSW 12 117584119 nonsense probably null
R2117:Rapgef5 UTSW 12 117714064 intron probably null
R2169:Rapgef5 UTSW 12 117715395 missense probably benign 0.25
R2903:Rapgef5 UTSW 12 117714119 missense probably damaging 1.00
R3983:Rapgef5 UTSW 12 117728670 missense possibly damaging 0.49
R4652:Rapgef5 UTSW 12 117714128 missense probably damaging 0.99
R4830:Rapgef5 UTSW 12 117756074 missense probably damaging 1.00
R5282:Rapgef5 UTSW 12 117739644 missense probably damaging 1.00
R5348:Rapgef5 UTSW 12 117688611 missense probably benign 0.24
R5456:Rapgef5 UTSW 12 117728646 splice site probably null
R5502:Rapgef5 UTSW 12 117721329 missense probably damaging 1.00
R5741:Rapgef5 UTSW 12 117756029 missense probably damaging 0.99
R5771:Rapgef5 UTSW 12 117721326 missense probably benign 0.45
R5905:Rapgef5 UTSW 12 117748426 missense probably damaging 1.00
R5941:Rapgef5 UTSW 12 117728738 missense probably damaging 1.00
R6228:Rapgef5 UTSW 12 117721663 intron probably null
R6233:Rapgef5 UTSW 12 117739718 critical splice donor site probably null
R6376:Rapgef5 UTSW 12 117721253 missense probably damaging 1.00
R6475:Rapgef5 UTSW 12 117718207 missense probably damaging 1.00
R7063:Rapgef5 UTSW 12 117689129 missense possibly damaging 0.91
R7410:Rapgef5 UTSW 12 117721328 missense probably damaging 1.00
R7445:Rapgef5 UTSW 12 117755969 missense probably benign 0.00
R7690:Rapgef5 UTSW 12 117721370 missense possibly damaging 0.72
R7707:Rapgef5 UTSW 12 117715344 missense probably damaging 1.00
R7815:Rapgef5 UTSW 12 117755967 missense probably benign 0.10
X0018:Rapgef5 UTSW 12 117718215 missense probably damaging 1.00
Z1176:Rapgef5 UTSW 12 117595288
Z1177:Rapgef5 UTSW 12 117688997
Predicted Primers PCR Primer
(F):5'- AAGGAAGTCTATTCTGCCCAC -3'
(R):5'- CTGTTCCATATGCCCAAAGAGACC -3'

Sequencing Primer
(F):5'- CCTTGTCAAATATGTGGCA -3'
(R):5'- CCTGGGAGTTACTCTGTGTACAAC -3'
Posted On2015-04-29