Incidental Mutation 'R4004:Ric1'
ID311408
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29579801 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 429 (R429C)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably benign
Transcript: ENSMUST00000043610
AA Change: R429C

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: R429C

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160221
Predicted Effect unknown
Transcript: ENSMUST00000162492
AA Change: R357C
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: R357C

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
R7619:Ric1 UTSW 19 29579775 missense probably benign 0.32
R7850:Ric1 UTSW 19 29594893 missense probably benign
R7933:Ric1 UTSW 19 29594893 missense probably benign
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACGGTTCAAACAATTGGGAC -3'
(R):5'- TCAGCAGCAGTCAGTAAATGAAC -3'

Sequencing Primer
(F):5'- AAGATCATTATGTAGGTTCTGTCATG -3'
(R):5'- GTCAGTAAATGAACACTCACCTG -3'
Posted On2015-04-29