Mutagenetix > Incidental Mutations

Incidental Mutation 'R4004:Ric1'

311408

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R4004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 29579801 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 429 (R429C)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

probably benign
Transcript: ENSMUST00000043610
AA Change: R429C

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: R429C

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160221

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: R357C

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: R357C

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	C	7: 79,100,687	E1735D	probably damaging	Het
Ano2	A	G	6: 126,013,279	R788G	probably damaging	Het
Atg9a	T	C	1: 75,186,451	Y335C	probably damaging	Het
BC067074	A	G	13: 113,318,380	Q320R	probably benign	Het
Capn10	T	A	1: 92,940,591	L260Q	probably damaging	Het
Ces1d	A	T	8: 93,178,092	F340Y	probably benign	Het
Ctbp2	C	A	7: 132,991,773	R733L	probably benign	Het
Dgkd	T	C	1: 87,935,423	I64T	possibly damaging	Het
Dmxl2	T	C	9: 54,446,390	I765V	probably benign	Het
Dync2h1	C	A	9: 7,117,404	C62F	probably damaging	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fcgr1	A	G	3: 96,284,352	V380A	probably benign	Het
Gif	T	G	19: 11,759,007	V314G	probably damaging	Het
Herc2	C	A	7: 56,106,465	P751Q	possibly damaging	Het
Ikzf3	C	T	11: 98,489,017	E142K	probably damaging	Het
Kctd3	A	G	1: 188,992,743	S214P	probably benign	Het
Lrpap1	T	A	5: 35,105,544	K50*	probably null	Het
Naa11	A	T	5: 97,391,793	Y169N	probably benign	Het
Nupl2	T	C	5: 24,182,436	I408T	probably damaging	Het
Olfr366	A	T	2: 37,219,948	H153L	probably benign	Het
Olfr721-ps1	C	T	14: 14,408,152	A308V	probably benign	Het
Plxnc1	G	A	10: 94,794,597	Q1512*	probably null	Het
Ptpn14	A	G	1: 189,850,510	N518S	probably benign	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Rpn2	T	C	2: 157,318,008	L548P	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Slc28a1	T	C	7: 81,169,038	S580P	probably damaging	Het
Slco6c1	A	G	1: 97,075,885	Y496H	probably damaging	Het
Spag5	T	C	11: 78,321,529	M1101T	probably benign	Het
Utp11	A	T	4: 124,682,437	F138I	probably damaging	Het
Vcp	G	A	4: 42,983,028	T606I	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp316	A	G	5: 143,255,119	S382P	possibly damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
R8477:Ric1	UTSW	19	29597783	missense	probably damaging	1.00
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACGGTTCAAACAATTGGGAC -3'
(R):5'- TCAGCAGCAGTCAGTAAATGAAC -3'

Sequencing Primer
(F):5'- AAGATCATTATGTAGGTTCTGTCATG -3'
(R):5'- GTCAGTAAATGAACACTCACCTG -3'

Posted On

2015-04-29