Incidental Mutation 'R4005:Dgkd'
ID311409
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R4005 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87935423 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 64 (I64T)
Ref Sequence ENSEMBL: ENSMUSP00000139658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000189448] [ENSMUST00000190061]
Predicted Effect probably benign
Transcript: ENSMUST00000027517
AA Change: I891T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: I891T

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185260
Predicted Effect probably benign
Transcript: ENSMUST00000189448
SMART Domains Protein: ENSMUSP00000139626
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 82 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189726
Predicted Effect possibly damaging
Transcript: ENSMUST00000190061
AA Change: I64T

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738
AA Change: I64T

DomainStartEndE-ValueType
DAGKa 1 95 7.6e-26 SMART
Blast:DAGKa 119 188 1e-23 BLAST
low complexity region 301 312 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T A 3: 89,749,787 L488Q probably damaging Het
Arhgef26 T C 3: 62,340,395 M300T probably benign Het
Asl C T 5: 130,018,832 probably null Het
BC080695 A G 4: 143,572,269 T261A probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Cdhr3 T C 12: 33,080,356 D160G probably damaging Het
Cep290 A G 10: 100,539,008 E1372G probably damaging Het
Cpeb2 A G 5: 43,238,412 probably benign Het
Cpeb4 G A 11: 31,925,390 A530T probably damaging Het
Cstl1 A T 2: 148,755,270 I64F probably damaging Het
Ddx28 C G 8: 106,010,928 R166P possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Edem3 T C 1: 151,759,755 M60T probably damaging Het
Farp1 C T 14: 121,276,397 R844W probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm996 T C 2: 25,578,856 T348A probably benign Het
Hmcn1 C G 1: 150,722,453 L1699F possibly damaging Het
Igsf10 A T 3: 59,328,560 L1400H probably benign Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Ilkap T A 1: 91,385,263 N170I probably benign Het
Kctd3 T G 1: 189,001,927 I39L possibly damaging Het
Lrit3 C A 3: 129,791,372 V246L probably benign Het
Magi1 A G 6: 93,701,318 I619T probably damaging Het
Map1b G T 13: 99,429,907 P2102H unknown Het
Mcm10 G T 2: 5,001,003 S440R probably damaging Het
Mtss1l CG CGG 8: 110,739,041 probably null Het
Nlrp9a A G 7: 26,558,550 N531S probably benign Het
Nrcam T A 12: 44,532,646 D31E probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ogn A C 13: 49,609,299 E39A possibly damaging Het
Olfr1284 G A 2: 111,379,743 V248I probably benign Het
Olfr1442 A T 19: 12,674,846 I214L probably benign Het
Olfr619 A G 7: 103,604,263 Y203C probably damaging Het
Rgs2 T A 1: 144,001,868 I150L probably benign Het
Rnf19a A T 15: 36,245,628 D490E probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Ulk4 A T 9: 121,168,199 L769Q possibly damaging Het
Ythdc2 A G 18: 44,833,128 S144G probably benign Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R0591:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87941501 critical splice donor site probably null
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R4864:Dgkd UTSW 1 87916838 missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87936381 missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6846:Dgkd UTSW 1 87925691 splice site probably null
R6905:Dgkd UTSW 1 87935375 missense probably damaging 1.00
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Z1176:Dgkd UTSW 1 87927810 missense probably benign 0.05
Z1177:Dgkd UTSW 1 87916886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTGTCTCACCAGAACCC -3'
(R):5'- TCTACCTCAGCAAGACTCAGAG -3'

Sequencing Primer
(F):5'- CCCCAGAACAGGAAGCAGAG -3'
(R):5'- ACTCAGAGCACTCAGTGGG -3'
Posted On2015-04-29