Incidental Mutation 'R4005:Cstl1'
ID311418
Institutional Source Beutler Lab
Gene Symbol Cstl1
Ensembl Gene ENSMUSG00000055177
Gene Namecystatin-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4005 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148750358-148755433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148755270 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 64 (I64F)
Ref Sequence ENSEMBL: ENSMUSP00000105580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109952] [ENSMUST00000109954] [ENSMUST00000109955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109952
AA Change: I116F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105578
Gene: ENSMUSG00000055177
AA Change: I116F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109954
AA Change: I64F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105580
Gene: ENSMUSG00000055177
AA Change: I64F

DomainStartEndE-ValueType
Pfam:Cystatin 13 74 5.5e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109955
AA Change: I116F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105581
Gene: ENSMUSG00000055177
AA Change: I116F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located at the telomeric end of the cystatin locus and encodes a type 2 cystatin-like protein. The specific function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T A 3: 89,749,787 L488Q probably damaging Het
Arhgef26 T C 3: 62,340,395 M300T probably benign Het
Asl C T 5: 130,018,832 probably null Het
BC080695 A G 4: 143,572,269 T261A probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Cdhr3 T C 12: 33,080,356 D160G probably damaging Het
Cep290 A G 10: 100,539,008 E1372G probably damaging Het
Cpeb2 A G 5: 43,238,412 probably benign Het
Cpeb4 G A 11: 31,925,390 A530T probably damaging Het
Ddx28 C G 8: 106,010,928 R166P possibly damaging Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Edem3 T C 1: 151,759,755 M60T probably damaging Het
Farp1 C T 14: 121,276,397 R844W probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm996 T C 2: 25,578,856 T348A probably benign Het
Hmcn1 C G 1: 150,722,453 L1699F possibly damaging Het
Igsf10 A T 3: 59,328,560 L1400H probably benign Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Ilkap T A 1: 91,385,263 N170I probably benign Het
Kctd3 T G 1: 189,001,927 I39L possibly damaging Het
Lrit3 C A 3: 129,791,372 V246L probably benign Het
Magi1 A G 6: 93,701,318 I619T probably damaging Het
Map1b G T 13: 99,429,907 P2102H unknown Het
Mcm10 G T 2: 5,001,003 S440R probably damaging Het
Mtss1l CG CGG 8: 110,739,041 probably null Het
Nlrp9a A G 7: 26,558,550 N531S probably benign Het
Nrcam T A 12: 44,532,646 D31E probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ogn A C 13: 49,609,299 E39A possibly damaging Het
Olfr1284 G A 2: 111,379,743 V248I probably benign Het
Olfr1442 A T 19: 12,674,846 I214L probably benign Het
Olfr619 A G 7: 103,604,263 Y203C probably damaging Het
Rgs2 T A 1: 144,001,868 I150L probably benign Het
Rnf19a A T 15: 36,245,628 D490E probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Ulk4 A T 9: 121,168,199 L769Q possibly damaging Het
Ythdc2 A G 18: 44,833,128 S144G probably benign Het
Other mutations in Cstl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Cstl1 UTSW 2 148755325 missense probably damaging 1.00
R0477:Cstl1 UTSW 2 148750988 missense probably benign 0.06
R1706:Cstl1 UTSW 2 148751159 splice site probably null
R2471:Cstl1 UTSW 2 148751121 nonsense probably null
R2938:Cstl1 UTSW 2 148751057 missense possibly damaging 0.59
R5071:Cstl1 UTSW 2 148750927 start codon destroyed probably benign 0.01
R7019:Cstl1 UTSW 2 148755303 missense probably benign 0.03
R8126:Cstl1 UTSW 2 148754671 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCCTATGCCAGGGTGTAGG -3'
(R):5'- ACCACGGGTCCTCTTACAATTTTAC -3'

Sequencing Primer
(F):5'- AGGAAGAAACTCTGTACTCCTTCCTG -3'
(R):5'- TCTTACAATTTTACACACCACAGG -3'
Posted On2015-04-29