Incidental Mutation 'R4005:BC080695'
ID311424
Institutional Source Beutler Lab
Gene Symbol BC080695
Ensembl Gene ENSMUSG00000070618
Gene NamecDNA sequence BC080695
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4005 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143551700-143573798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143572269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 261 (T261A)
Ref Sequence ENSEMBL: ENSMUSP00000101400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105765] [ENSMUST00000105774]
Predicted Effect probably benign
Transcript: ENSMUST00000105765
AA Change: T261A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101391
Gene: ENSMUSG00000070618
AA Change: T261A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105774
AA Change: T261A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101400
Gene: ENSMUSG00000070618
AA Change: T261A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T A 3: 89,749,787 L488Q probably damaging Het
Arhgef26 T C 3: 62,340,395 M300T probably benign Het
Asl C T 5: 130,018,832 probably null Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Cdhr3 T C 12: 33,080,356 D160G probably damaging Het
Cep290 A G 10: 100,539,008 E1372G probably damaging Het
Cpeb2 A G 5: 43,238,412 probably benign Het
Cpeb4 G A 11: 31,925,390 A530T probably damaging Het
Cstl1 A T 2: 148,755,270 I64F probably damaging Het
Ddx28 C G 8: 106,010,928 R166P possibly damaging Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Edem3 T C 1: 151,759,755 M60T probably damaging Het
Farp1 C T 14: 121,276,397 R844W probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm996 T C 2: 25,578,856 T348A probably benign Het
Hmcn1 C G 1: 150,722,453 L1699F possibly damaging Het
Igsf10 A T 3: 59,328,560 L1400H probably benign Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Ilkap T A 1: 91,385,263 N170I probably benign Het
Kctd3 T G 1: 189,001,927 I39L possibly damaging Het
Lrit3 C A 3: 129,791,372 V246L probably benign Het
Magi1 A G 6: 93,701,318 I619T probably damaging Het
Map1b G T 13: 99,429,907 P2102H unknown Het
Mcm10 G T 2: 5,001,003 S440R probably damaging Het
Mtss1l CG CGG 8: 110,739,041 probably null Het
Nlrp9a A G 7: 26,558,550 N531S probably benign Het
Nrcam T A 12: 44,532,646 D31E probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ogn A C 13: 49,609,299 E39A possibly damaging Het
Olfr1284 G A 2: 111,379,743 V248I probably benign Het
Olfr1442 A T 19: 12,674,846 I214L probably benign Het
Olfr619 A G 7: 103,604,263 Y203C probably damaging Het
Rgs2 T A 1: 144,001,868 I150L probably benign Het
Rnf19a A T 15: 36,245,628 D490E probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Ulk4 A T 9: 121,168,199 L769Q possibly damaging Het
Ythdc2 A G 18: 44,833,128 S144G probably benign Het
Other mutations in BC080695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:BC080695 APN 4 143571156 missense probably benign 0.42
IGL02533:BC080695 APN 4 143571002 utr 5 prime probably benign
R0352:BC080695 UTSW 4 143571308 splice site probably benign
R1600:BC080695 UTSW 4 143571967 missense possibly damaging 0.78
R3121:BC080695 UTSW 4 143571013 start codon destroyed probably null 1.00
R4477:BC080695 UTSW 4 143571162 missense probably benign 0.21
R4639:BC080695 UTSW 4 143571897 missense probably benign 0.22
R4791:BC080695 UTSW 4 143570989 start gained probably benign
R5118:BC080695 UTSW 4 143571127 missense probably damaging 1.00
R5353:BC080695 UTSW 4 143571237 missense probably benign 0.00
R5861:BC080695 UTSW 4 143571240 missense probably benign
R6163:BC080695 UTSW 4 143572035 missense probably damaging 1.00
R6286:BC080695 UTSW 4 143571226 missense probably benign
R6958:BC080695 UTSW 4 143571259 missense probably damaging 1.00
R7391:BC080695 UTSW 4 143572306 missense probably damaging 1.00
R7625:BC080695 UTSW 4 143572251 missense probably benign 0.00
R8189:BC080695 UTSW 4 143571960 missense probably benign
R8190:BC080695 UTSW 4 143571960 missense probably benign
R8192:BC080695 UTSW 4 143571960 missense probably benign
R8219:BC080695 UTSW 4 143571960 missense probably benign
R8221:BC080695 UTSW 4 143571960 missense probably benign
R8223:BC080695 UTSW 4 143571960 missense probably benign
R8226:BC080695 UTSW 4 143571960 missense probably benign
Z1176:BC080695 UTSW 4 143572252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGATTAGGGAATTGCCTATGC -3'
(R):5'- ACCATGGCCCCTAGTCTATATG -3'

Sequencing Primer
(F):5'- TGCCTATGCACACTGTAAGG -3'
(R):5'- TGGCCCCTAGTCTATATGGGAAAC -3'
Posted On2015-04-29