Incidental Mutation 'R4005:Cep290'
ID311437
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R4005 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100539008 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1372 (E1372G)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219408] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably damaging
Transcript: ENSMUST00000164751
AA Change: E1372G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: E1372G

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218703
Predicted Effect probably benign
Transcript: ENSMUST00000219408
Predicted Effect probably damaging
Transcript: ENSMUST00000219765
AA Change: E1365G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000220346
AA Change: E1372G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T A 3: 89,749,787 L488Q probably damaging Het
Arhgef26 T C 3: 62,340,395 M300T probably benign Het
Asl C T 5: 130,018,832 probably null Het
BC080695 A G 4: 143,572,269 T261A probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Cdhr3 T C 12: 33,080,356 D160G probably damaging Het
Cpeb2 A G 5: 43,238,412 probably benign Het
Cpeb4 G A 11: 31,925,390 A530T probably damaging Het
Cstl1 A T 2: 148,755,270 I64F probably damaging Het
Ddx28 C G 8: 106,010,928 R166P possibly damaging Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Edem3 T C 1: 151,759,755 M60T probably damaging Het
Farp1 C T 14: 121,276,397 R844W probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm996 T C 2: 25,578,856 T348A probably benign Het
Hmcn1 C G 1: 150,722,453 L1699F possibly damaging Het
Igsf10 A T 3: 59,328,560 L1400H probably benign Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Ilkap T A 1: 91,385,263 N170I probably benign Het
Kctd3 T G 1: 189,001,927 I39L possibly damaging Het
Lrit3 C A 3: 129,791,372 V246L probably benign Het
Magi1 A G 6: 93,701,318 I619T probably damaging Het
Map1b G T 13: 99,429,907 P2102H unknown Het
Mcm10 G T 2: 5,001,003 S440R probably damaging Het
Mtss1l CG CGG 8: 110,739,041 probably null Het
Nlrp9a A G 7: 26,558,550 N531S probably benign Het
Nrcam T A 12: 44,532,646 D31E probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ogn A C 13: 49,609,299 E39A possibly damaging Het
Olfr1284 G A 2: 111,379,743 V248I probably benign Het
Olfr1442 A T 19: 12,674,846 I214L probably benign Het
Olfr619 A G 7: 103,604,263 Y203C probably damaging Het
Rgs2 T A 1: 144,001,868 I150L probably benign Het
Rnf19a A T 15: 36,245,628 D490E probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Ulk4 A T 9: 121,168,199 L769Q possibly damaging Het
Ythdc2 A G 18: 44,833,128 S144G probably benign Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 intron probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCAAATGTTACTAGGCTATTCATTTCG -3'
(R):5'- GTGTTCTAAATCAGCACTGACATC -3'

Sequencing Primer
(F):5'- AGCTTTGCCATTAATTTCG -3'
(R):5'- GCATGTTTGGGAATTTAAAAAGCAAG -3'
Posted On2015-04-29