Incidental Mutation 'R4006:AI481877'
ID311463
Institutional Source Beutler Lab
Gene Symbol AI481877
Ensembl Gene ENSMUSG00000038598
Gene Nameexpressed sequence AI481877
SynonymsLOC242489, Gm426
MMRRC Submission 040845-MU
Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59043753-59138983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59076500 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 481 (V481D)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107547
AA Change: V481D

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: V481D

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122832
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in AI481877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:AI481877 APN 4 59086961 missense probably benign
IGL00574:AI481877 APN 4 59094201 missense possibly damaging 0.66
IGL01333:AI481877 APN 4 59047870 missense possibly damaging 0.66
IGL02282:AI481877 APN 4 59111114 missense unknown
IGL02418:AI481877 APN 4 59049075 splice site probably benign
IGL02621:AI481877 APN 4 59062668 missense probably damaging 0.97
IGL03028:AI481877 APN 4 59094274 missense possibly damaging 0.66
IGL03112:AI481877 APN 4 59049355 missense probably benign 0.27
IGL03137:AI481877 APN 4 59094162 missense probably benign 0.27
IGL03220:AI481877 APN 4 59082378 nonsense probably null
IGL03386:AI481877 APN 4 59069315 missense possibly damaging 0.66
1mM(1):AI481877 UTSW 4 59048024 nonsense probably null
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0194:AI481877 UTSW 4 59066534 splice site probably benign
R0366:AI481877 UTSW 4 59099410 missense probably benign 0.09
R0680:AI481877 UTSW 4 59043967 missense probably benign 0.00
R1419:AI481877 UTSW 4 59064457 missense possibly damaging 0.66
R1599:AI481877 UTSW 4 59072349 missense possibly damaging 0.82
R1699:AI481877 UTSW 4 59113926 missense unknown
R1799:AI481877 UTSW 4 59099383 missense possibly damaging 0.92
R1832:AI481877 UTSW 4 59066441 missense probably benign 0.05
R1870:AI481877 UTSW 4 59054142 splice site probably benign
R2076:AI481877 UTSW 4 59082410 missense possibly damaging 0.46
R2170:AI481877 UTSW 4 59069215 missense possibly damaging 0.92
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2873:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R3026:AI481877 UTSW 4 59062656 missense possibly damaging 0.83
R3079:AI481877 UTSW 4 59047848 missense possibly damaging 0.82
R3853:AI481877 UTSW 4 59047390 missense possibly damaging 0.66
R3914:AI481877 UTSW 4 59094201 missense possibly damaging 0.66
R4364:AI481877 UTSW 4 59082294 missense possibly damaging 0.92
R4387:AI481877 UTSW 4 59060915 missense possibly damaging 0.66
R4454:AI481877 UTSW 4 59092383 missense possibly damaging 0.90
R4811:AI481877 UTSW 4 59082404 missense probably benign 0.19
R4853:AI481877 UTSW 4 59072345 missense possibly damaging 0.66
R4899:AI481877 UTSW 4 59062640 missense probably damaging 0.97
R5090:AI481877 UTSW 4 59111108 missense unknown
R5169:AI481877 UTSW 4 59059618 missense possibly damaging 0.66
R5297:AI481877 UTSW 4 59047543 missense probably benign
R5400:AI481877 UTSW 4 59082432 missense possibly damaging 0.83
R5419:AI481877 UTSW 4 59049017 missense probably benign 0.04
R5668:AI481877 UTSW 4 59047399 missense probably benign
R5770:AI481877 UTSW 4 59092466 missense probably benign 0.00
R5783:AI481877 UTSW 4 59076239 nonsense probably null
R5929:AI481877 UTSW 4 59092497 nonsense probably null
R6209:AI481877 UTSW 4 59043869 makesense probably null
R6230:AI481877 UTSW 4 59099345 missense probably benign
R6233:AI481877 UTSW 4 59076245 missense possibly damaging 0.92
R6351:AI481877 UTSW 4 59069317 missense probably benign 0.00
R6785:AI481877 UTSW 4 59049066 missense probably benign 0.01
R6884:AI481877 UTSW 4 59059652 missense possibly damaging 0.83
R7355:AI481877 UTSW 4 59076155 missense probably benign
R7423:AI481877 UTSW 4 59076264 missense probably benign 0.27
R7484:AI481877 UTSW 4 59062286 missense probably damaging 0.97
R7560:AI481877 UTSW 4 59076140 missense possibly damaging 0.66
R7999:AI481877 UTSW 4 59094162 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCAGATGGCACTTGACTTGAAC -3'
(R):5'- GCTCATTCTATTTAGAAGCAAAAGTGG -3'

Sequencing Primer
(F):5'- GGCACTTGACTTGAACAGCCAAG -3'
(R):5'- TTTTCCAAACACTAAACAAAATACCC -3'
Posted On2015-04-29