Incidental Mutation 'R4006:Iqsec3'
ID311469
Institutional Source Beutler Lab
Gene Symbol Iqsec3
Ensembl Gene ENSMUSG00000040797
Gene NameIQ motif and Sec7 domain 3
SynonymssynarfGEF, BRAG3
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location121372933-121473678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121376228 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1144 (S1144P)
Ref Sequence ENSEMBL: ENSMUSP00000038653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046373] [ENSMUST00000129815] [ENSMUST00000152103]
Predicted Effect probably damaging
Transcript: ENSMUST00000046373
AA Change: S1144P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038653
Gene: ENSMUSG00000040797
AA Change: S1144P

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Blast:Sec7 285 354 5e-16 BLAST
low complexity region 367 386 N/A INTRINSIC
Blast:Sec7 476 507 2e-9 BLAST
low complexity region 508 531 N/A INTRINSIC
low complexity region 542 594 N/A INTRINSIC
low complexity region 598 628 N/A INTRINSIC
Sec7 652 843 9.53e-89 SMART
PH 874 985 4.03e0 SMART
low complexity region 1065 1105 N/A INTRINSIC
low complexity region 1126 1144 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
low complexity region 1182 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129815
SMART Domains Protein: ENSMUSP00000120847
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152103
SMART Domains Protein: ENSMUSP00000116317
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Meta Mutation Damage Score 0.1438 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Iqsec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Iqsec3 APN 6 121473124 missense possibly damaging 0.90
IGL01615:Iqsec3 APN 6 121410621 missense probably damaging 1.00
IGL01728:Iqsec3 APN 6 121412664 utr 3 prime probably benign
IGL01935:Iqsec3 APN 6 121383992 missense probably damaging 1.00
IGL02146:Iqsec3 APN 6 121383957 missense probably damaging 0.99
IGL02369:Iqsec3 APN 6 121412934 utr 3 prime probably benign
IGL02684:Iqsec3 APN 6 121412941 nonsense probably null
IGL03180:Iqsec3 APN 6 121413508 utr 3 prime probably benign
R0032:Iqsec3 UTSW 6 121473130 missense possibly damaging 0.71
R0088:Iqsec3 UTSW 6 121473289 missense probably damaging 0.97
R0189:Iqsec3 UTSW 6 121413562 utr 3 prime probably benign
R0193:Iqsec3 UTSW 6 121410724 missense probably damaging 1.00
R0528:Iqsec3 UTSW 6 121412784 utr 3 prime probably benign
R1885:Iqsec3 UTSW 6 121428367 intron probably benign
R2698:Iqsec3 UTSW 6 121413471 utr 3 prime probably benign
R3751:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3753:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3947:Iqsec3 UTSW 6 121387824 nonsense probably null
R3948:Iqsec3 UTSW 6 121387824 nonsense probably null
R3949:Iqsec3 UTSW 6 121387824 nonsense probably null
R4007:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4210:Iqsec3 UTSW 6 121413040 utr 3 prime probably benign
R4535:Iqsec3 UTSW 6 121380018 missense possibly damaging 0.80
R4567:Iqsec3 UTSW 6 121387762 missense probably damaging 1.00
R5096:Iqsec3 UTSW 6 121386698 missense probably damaging 1.00
R5135:Iqsec3 UTSW 6 121383919 missense probably damaging 1.00
R5289:Iqsec3 UTSW 6 121386700 critical splice acceptor site probably null
R5537:Iqsec3 UTSW 6 121412644 utr 3 prime probably benign
R6555:Iqsec3 UTSW 6 121384219 missense probably damaging 1.00
R6942:Iqsec3 UTSW 6 121473103 missense probably damaging 1.00
R7122:Iqsec3 UTSW 6 121473358 missense unknown
R7372:Iqsec3 UTSW 6 121384032 nonsense probably null
R7394:Iqsec3 UTSW 6 121386610 missense possibly damaging 0.47
R7559:Iqsec3 UTSW 6 121387780 missense probably damaging 1.00
R7729:Iqsec3 UTSW 6 121383981 missense probably damaging 1.00
R7815:Iqsec3 UTSW 6 121473358 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTAAGGGTAGAGCCTACACCAG -3'
(R):5'- TTCACAACAGGCTTCAAACG -3'

Sequencing Primer
(F):5'- GCAGAACTGATGAGGGTGGTTGT -3'
(R):5'- AGCACAGCCCCAAGTTGG -3'
Posted On2015-04-29