Incidental Mutation 'R4006:Olfr513'
ID 311474
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Name olfactory receptor 513
Synonyms MOR195-1, GA_x6K02T2PBJ9-11084889-11085818
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R4006 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 108750973-108756800 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108755261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 135 (T135I)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
AlphaFold Q8VFZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000055146
AA Change: T135I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: T135I

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214670
AA Change: T135I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1251:Olfr513 UTSW 7 108754907 missense probably damaging 0.99
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1582:Olfr513 UTSW 7 108755110 missense probably benign 0.04
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R4881:Olfr513 UTSW 7 108755405 missense probably damaging 1.00
R5132:Olfr513 UTSW 7 108755270 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5848:Olfr513 UTSW 7 108755574 nonsense probably null
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
R7783:Olfr513 UTSW 7 108755569 missense probably damaging 1.00
R8113:Olfr513 UTSW 7 108755231 missense probably damaging 1.00
R8385:Olfr513 UTSW 7 108755304 nonsense probably null
R9429:Olfr513 UTSW 7 108755205 missense probably damaging 0.98
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCTTCACACGCCAATGTAC -3'
(R):5'- GATCAGAAGCTGCCTCTCTTTG -3'

Sequencing Primer
(F):5'- CTTCCATTGGGCCAAAAATGCTG -3'
(R):5'- CAGAAGCTGCCTCTCTTTGTTGTG -3'
Posted On 2015-04-29