Incidental Mutation 'R4006:Xylt1'
ID311475
Institutional Source Beutler Lab
Gene Symbol Xylt1
Ensembl Gene ENSMUSG00000030657
Gene Namexylosyltransferase 1
Synonyms
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location117380979-117673580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117475513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 122 (I122V)
Ref Sequence ENSEMBL: ENSMUSP00000032892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032892]
Predicted Effect probably benign
Transcript: ENSMUST00000032892
AA Change: I122V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032892
Gene: ENSMUSG00000030657
AA Change: I122V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 75 104 N/A INTRINSIC
Pfam:Branch 322 577 7.8e-53 PFAM
Pfam:Xylo_C 607 787 2.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161889
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial preweaning lethality, impaired chondrocyte maturation and decreased skeletal length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Xylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Xylt1 APN 7 117650685 missense probably damaging 0.99
IGL01306:Xylt1 APN 7 117548890 missense probably benign 0.00
IGL01656:Xylt1 APN 7 117548993 missense probably damaging 1.00
IGL02152:Xylt1 APN 7 117634770 missense probably damaging 1.00
IGL02188:Xylt1 APN 7 117634737 missense probably damaging 1.00
IGL02732:Xylt1 APN 7 117591937 missense possibly damaging 0.75
IGL02944:Xylt1 APN 7 117634757 missense probably benign 0.00
IGL03308:Xylt1 APN 7 117637751 nonsense probably null
IGL03393:Xylt1 APN 7 117593713 missense probably damaging 1.00
phloem UTSW 7 117656584 missense probably damaging 1.00
xylem UTSW 7 117592036 missense probably damaging 1.00
ANU23:Xylt1 UTSW 7 117548890 missense probably benign 0.00
PIT4378001:Xylt1 UTSW 7 117548865 missense possibly damaging 0.83
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0970:Xylt1 UTSW 7 117634736 missense probably damaging 0.96
R1433:Xylt1 UTSW 7 117591952 missense possibly damaging 0.51
R1762:Xylt1 UTSW 7 117637761 missense probably benign 0.00
R2169:Xylt1 UTSW 7 117667437 missense probably damaging 1.00
R2937:Xylt1 UTSW 7 117634784 missense probably benign 0.04
R3024:Xylt1 UTSW 7 117548648 missense probably damaging 1.00
R3855:Xylt1 UTSW 7 117593550 missense probably damaging 1.00
R4329:Xylt1 UTSW 7 117656461 missense probably damaging 1.00
R4794:Xylt1 UTSW 7 117637635 missense probably benign 0.07
R4975:Xylt1 UTSW 7 117667342 missense probably damaging 1.00
R5225:Xylt1 UTSW 7 117592036 missense probably damaging 1.00
R5679:Xylt1 UTSW 7 117643650 missense probably damaging 1.00
R5707:Xylt1 UTSW 7 117656494 missense possibly damaging 0.95
R5756:Xylt1 UTSW 7 117650700 missense probably damaging 0.97
R5802:Xylt1 UTSW 7 117656691 missense probably benign 0.43
R6057:Xylt1 UTSW 7 117591908 missense probably benign 0.02
R6249:Xylt1 UTSW 7 117667305 missense probably benign 0.11
R6298:Xylt1 UTSW 7 117656737 missense probably damaging 0.96
R7159:Xylt1 UTSW 7 117637602 missense probably damaging 1.00
R7198:Xylt1 UTSW 7 117656584 missense probably damaging 1.00
R7323:Xylt1 UTSW 7 117592047 critical splice donor site probably null
R7449:Xylt1 UTSW 7 117592005 missense possibly damaging 0.55
R7545:Xylt1 UTSW 7 117593585 missense probably benign 0.11
R7849:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7867:Xylt1 UTSW 7 117475514 missense probably benign 0.12
R7932:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7950:Xylt1 UTSW 7 117475514 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAAGGAAAGGAGTGCTGCGTTTC -3'
(R):5'- TTAATCCAGTTGGGGTGGCC -3'

Sequencing Primer
(F):5'- TGCGTTTCAGCAGGGGG -3'
(R):5'- TGGCCAGTTACTGAGCCAAG -3'
Posted On2015-04-29