Incidental Mutation 'R4006:Mc1r'
ID311480
Institutional Source Beutler Lab
Gene Symbol Mc1r
Ensembl Gene ENSMUSG00000074037
Gene Namemelanocortin 1 receptor
Synonymsextension recessive yellow, e, Mshra
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123407107-123410744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123407637 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 43 (F43S)
Ref Sequence ENSEMBL: ENSMUSP00000095929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000098324] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212571] [ENSMUST00000212743] [ENSMUST00000212880]
Predicted Effect probably benign
Transcript: ENSMUST00000071134
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098324
AA Change: F43S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095929
Gene: ENSMUSG00000074037
AA Change: F43S

DomainStartEndE-ValueType
Pfam:7tm_4 43 188 1.3e-13 PFAM
Pfam:7TM_GPCR_Srsx 47 311 1e-7 PFAM
Pfam:7tm_1 53 296 2.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195600
Predicted Effect probably benign
Transcript: ENSMUST00000211932
Predicted Effect probably benign
Transcript: ENSMUST00000212470
Predicted Effect probably benign
Transcript: ENSMUST00000212571
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212880
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Spontaneous(6) Chemically induced(2)
Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity.

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Mc1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Mc1r APN 8 123408050 missense probably damaging 1.00
IGL02878:Mc1r APN 8 123407630 missense probably damaging 1.00
deer UTSW 8 123407958 missense probably damaging 1.00
R1240:Mc1r UTSW 8 123408260 missense probably damaging 1.00
R1871:Mc1r UTSW 8 123407536 missense probably benign
R2071:Mc1r UTSW 8 123408369 missense possibly damaging 0.84
R4226:Mc1r UTSW 8 123407856 missense possibly damaging 0.88
R4865:Mc1r UTSW 8 123407516 missense probably benign 0.25
R6652:Mc1r UTSW 8 123407631 missense probably damaging 1.00
R6765:Mc1r UTSW 8 123407696 missense probably damaging 1.00
R7580:Mc1r UTSW 8 123408167 missense probably damaging 1.00
R7609:Mc1r UTSW 8 123408293 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGAGGGATGTCAGAGACC -3'
(R):5'- TCCAGCAGCAGGATGATAGTAG -3'

Sequencing Primer
(F):5'- TGATACCACCTGGAGCTGCAG -3'
(R):5'- TGATAGTAGTCTCCAGCACGATGC -3'
Posted On2015-04-29