Incidental Mutation 'R4006:Camkv'
ID311483
Institutional Source Beutler Lab
Gene Symbol Camkv
Ensembl Gene ENSMUSG00000032936
Gene NameCaM kinase-like vesicle-associated
Synonyms
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107935674-107949691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107946641 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 196 (R196W)
Ref Sequence ENSEMBL: ENSMUSP00000040430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035700] [ENSMUST00000049348] [ENSMUST00000193533] [ENSMUST00000194206] [ENSMUST00000194271] [ENSMUST00000195219]
Predicted Effect probably damaging
Transcript: ENSMUST00000035700
AA Change: R196W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040430
Gene: ENSMUSG00000032936
AA Change: R196W

DomainStartEndE-ValueType
S_TKc 24 286 4.21e-81 SMART
low complexity region 332 385 N/A INTRINSIC
internal_repeat_1 392 425 3.43e-15 PROSPERO
internal_repeat_1 416 449 3.43e-15 PROSPERO
low complexity region 461 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049348
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192567
Predicted Effect probably benign
Transcript: ENSMUST00000193533
Predicted Effect probably benign
Transcript: ENSMUST00000194206
SMART Domains Protein: ENSMUSP00000141444
Gene: ENSMUSG00000032936

DomainStartEndE-ValueType
STYKc 24 258 2.3e-8 SMART
low complexity region 304 357 N/A INTRINSIC
internal_repeat_1 364 397 2.93e-15 PROSPERO
internal_repeat_1 388 421 2.93e-15 PROSPERO
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194271
SMART Domains Protein: ENSMUSP00000141689
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 3.2e-8 SMART
coiled coil region 54 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194538
Predicted Effect probably benign
Transcript: ENSMUST00000195219
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Camkv
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0288:Camkv UTSW 9 107946356 missense probably damaging 1.00
R0834:Camkv UTSW 9 107945846 missense probably damaging 1.00
R1919:Camkv UTSW 9 107947088 missense possibly damaging 0.89
R1996:Camkv UTSW 9 107947121 missense probably damaging 1.00
R2165:Camkv UTSW 9 107945600 missense possibly damaging 0.48
R3943:Camkv UTSW 9 107947983 missense possibly damaging 0.70
R4357:Camkv UTSW 9 107947946 missense probably benign 0.27
R4406:Camkv UTSW 9 107946219 critical splice donor site probably null
R4601:Camkv UTSW 9 107946096 missense probably damaging 0.99
R5078:Camkv UTSW 9 107945373 missense probably damaging 0.99
R5175:Camkv UTSW 9 107947382 missense probably damaging 1.00
R5373:Camkv UTSW 9 107946889 missense probably benign 0.05
R5379:Camkv UTSW 9 107945346 missense probably damaging 0.99
R5480:Camkv UTSW 9 107946875 missense probably damaging 1.00
R5484:Camkv UTSW 9 107946146 missense probably damaging 1.00
R6335:Camkv UTSW 9 107946695 critical splice donor site probably null
R6730:Camkv UTSW 9 107948317 missense possibly damaging 0.73
RF010:Camkv UTSW 9 107947860 unclassified probably benign
RF039:Camkv UTSW 9 107947860 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAAGCTAGAGAATGGCC -3'
(R):5'- TTCCACCTCCTCGTAGAAGG -3'

Sequencing Primer
(F):5'- CTTATCAAGGAGCCCTGTGGAAC -3'
(R):5'- CCTCGTAGAAGGGCGGGTTG -3'
Posted On2015-04-29