Incidental Mutation 'R4006:Psmb11'
ID311489
Institutional Source Beutler Lab
Gene Symbol Psmb11
Ensembl Gene ENSMUSG00000072423
Gene Nameproteasome (prosome, macropain) subunit, beta type, 11
Synonyms5830406J20Rik, beta5t
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54621433-54629556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54625646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 107 (V107E)
Ref Sequence ENSEMBL: ENSMUSP00000132140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097177] [ENSMUST00000228446]
Predicted Effect probably damaging
Transcript: ENSMUST00000097177
AA Change: V107E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132140
Gene: ENSMUSG00000072423
AA Change: V107E

DomainStartEndE-ValueType
Pfam:Proteasome 46 228 3.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228446
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteasomes generate peptides that are presented by major histocompatibility complex (MHC) I molecules to other cells of the immune system. Proteolysis is conducted by 20S proteasomes, complexes of 28 subunits arranged as a cylinder in 4 heteroheptameric rings: alpha-1 to -7, beta-1 to -7, beta-1 to -7, and alpha-1 to -7. The catalytic subunits are beta-1 (PSMB6; MIM 600307), beta-2 (PSMB7; MIM 604030), and beta-5 (PSMB5; MIM 600306). Three additional subunits, beta-1i (PSMB9; MIM 177045), beta-2i (PSMB10; MIM 176847), and beta-5i (PSMB8; MIM 177046), are induced by gamma-interferon (IFNG; MIM 147570) and are preferentially incorporated into proteasomes to make immunoproteasomes. PSMB11, or beta-5t, is a catalytic subunit expressed exclusively in cortical thymic epithelial cells (Murata et al., 2007 [PubMed 17540904]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele have fewer CD8+ single positive cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Psmb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Psmb11 APN 14 54625651 missense probably damaging 0.98
IGL03057:Psmb11 APN 14 54625779 nonsense probably null
R2971:Psmb11 UTSW 14 54625343 missense possibly damaging 0.90
R6228:Psmb11 UTSW 14 54626189 missense probably benign
R7229:Psmb11 UTSW 14 54625951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTTCCTGCAGATCCATG -3'
(R):5'- CAAGTGCCATCGCTGTAGAC -3'

Sequencing Primer
(F):5'- TGGCTCATGGCACCACTAC -3'
(R):5'- TGCCATCGCTGTAGACATAGAAG -3'
Posted On2015-04-29