Incidental Mutation 'R4006:Htr2a'
ID311490
Institutional Source Beutler Lab
Gene Symbol Htr2a
Ensembl Gene ENSMUSG00000034997
Gene Name5-hydroxytryptamine (serotonin) receptor 2A
SynonymsHtr2, 5-HT2A receptor, Htr-2
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location74640840-74709494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74642141 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 70 (H70L)
Ref Sequence ENSEMBL: ENSMUSP00000047774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036653]
Predicted Effect probably benign
Transcript: ENSMUST00000036653
AA Change: H70L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047774
Gene: ENSMUSG00000034997
AA Change: H70L

DomainStartEndE-ValueType
Pfam:7tm_4 81 264 1.2e-9 PFAM
Pfam:7TM_GPCR_Srx 82 289 1e-6 PFAM
Pfam:7TM_GPCR_Srsx 85 395 1.1e-16 PFAM
Pfam:7tm_1 91 380 5.9e-70 PFAM
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show altered anxiety-related responses and increased vertical activity. Mice homozygous for a different knock-out allele exhibit abnormal enterocyte, Paneth cell and smooth muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Htr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Htr2a APN 14 74706205 missense possibly damaging 0.93
IGL00946:Htr2a APN 14 74706142 nonsense probably null
IGL01660:Htr2a APN 14 74705754 missense probably damaging 1.00
IGL02200:Htr2a APN 14 74706165 missense probably damaging 1.00
IGL02369:Htr2a APN 14 74706282 missense probably benign 0.17
IGL02724:Htr2a APN 14 74645062 missense probably damaging 1.00
IGL02887:Htr2a APN 14 74645143 missense probably benign 0.05
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0117:Htr2a UTSW 14 74645093 missense probably damaging 1.00
R0367:Htr2a UTSW 14 74642209 missense probably damaging 1.00
R0513:Htr2a UTSW 14 74706324 missense probably benign 0.00
R0729:Htr2a UTSW 14 74642147 missense probably benign
R1507:Htr2a UTSW 14 74705979 missense probably damaging 1.00
R1522:Htr2a UTSW 14 74705853 nonsense probably null
R1539:Htr2a UTSW 14 74645168 missense possibly damaging 0.66
R1735:Htr2a UTSW 14 74706128 missense probably damaging 1.00
R1747:Htr2a UTSW 14 74706153 missense probably damaging 1.00
R1854:Htr2a UTSW 14 74705753 missense probably damaging 1.00
R2232:Htr2a UTSW 14 74645029 missense probably damaging 1.00
R2348:Htr2a UTSW 14 74645110 missense probably damaging 1.00
R3154:Htr2a UTSW 14 74705822 missense probably benign 0.00
R3401:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4007:Htr2a UTSW 14 74642141 missense probably benign
R4093:Htr2a UTSW 14 74706349 missense probably benign
R4094:Htr2a UTSW 14 74706349 missense probably benign
R4095:Htr2a UTSW 14 74706349 missense probably benign
R4502:Htr2a UTSW 14 74641988 missense probably benign 0.02
R4720:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4932:Htr2a UTSW 14 74642022 missense probably benign
R5651:Htr2a UTSW 14 74705703 missense probably damaging 0.98
R5935:Htr2a UTSW 14 74645090 missense probably damaging 1.00
R6175:Htr2a UTSW 14 74645034 nonsense probably null
R6937:Htr2a UTSW 14 74645164 missense probably damaging 0.98
R7138:Htr2a UTSW 14 74705742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTCCGGCTTAGACATGG -3'
(R):5'- TAACATGGACACGGGCATGAC -3'

Sequencing Primer
(F):5'- CCGGCTTAGACATGGAAATTCTCTG -3'
(R):5'- CGGGCATGACAAGGAAACCC -3'
Posted On2015-04-29