Incidental Mutation 'R4006:Zbtb20'
ID 311492
Institutional Source Beutler Lab
Gene Symbol Zbtb20
Ensembl Gene ENSMUSG00000022708
Gene Name zinc finger and BTB domain containing 20
Synonyms D16Wsu73e, Zfp288, HOF, 7330412A13Rik, 1300017A20Rik, A930017C21Rik
MMRRC Submission 040845-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4006 (G1)
Quality Score 158
Status Not validated
Chromosome 16
Chromosomal Location 42728008-43462981 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43429762 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000124189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]
AlphaFold Q8K0L9
Predicted Effect probably damaging
Transcript: ENSMUST00000079441
AA Change: L91P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: L91P

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114690
AA Change: L18P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: L18P

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114691
AA Change: L18P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: L18P

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114694
AA Change: L91P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: L91P

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114695
AA Change: L91P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: L91P

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146708
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708
AA Change: L18P

DomainStartEndE-ValueType
Pfam:BTB 21 74 3.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148775
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708
AA Change: L18P

DomainStartEndE-ValueType
Pfam:BTB 21 60 9.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156367
AA Change: L91P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708
AA Change: L91P

DomainStartEndE-ValueType
Pfam:BTB 94 131 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156981
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708
AA Change: L18P

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,038,600 (GRCm39) probably null Het
Ano4 C A 10: 88,924,125 (GRCm39) V329L probably benign Het
Camkv C T 9: 107,823,840 (GRCm39) R196W probably damaging Het
Chd9 T C 8: 91,660,188 (GRCm39) S383P probably benign Het
Cimip1 T C 2: 173,367,880 (GRCm39) probably null Het
Cul4a A G 8: 13,172,859 (GRCm39) N164S probably benign Het
Dsg4 G A 18: 20,604,022 (GRCm39) E830K probably damaging Het
Fbln2 C A 6: 91,246,943 (GRCm39) probably null Het
Grm8 T C 6: 27,981,229 (GRCm39) Y227C probably damaging Het
Gsn G A 2: 35,197,633 (GRCm39) W717* probably null Het
Htr2a A T 14: 74,879,581 (GRCm39) H70L probably benign Het
Igfn1 C T 1: 135,910,100 (GRCm39) probably null Het
Iqsec3 A G 6: 121,353,187 (GRCm39) S1144P probably damaging Het
Lpin2 C T 17: 71,553,496 (GRCm39) T878I probably damaging Het
Lrrn2 A T 1: 132,865,478 (GRCm39) D181V probably damaging Het
Mc1r T C 8: 124,134,376 (GRCm39) F43S probably damaging Het
Mst1 A G 9: 107,960,147 (GRCm39) E377G possibly damaging Het
Nfatc3 T A 8: 106,835,471 (GRCm39) I931N probably benign Het
Nup188 G A 2: 30,199,890 (GRCm39) D305N probably damaging Het
Or5e1 C T 7: 108,354,468 (GRCm39) T135I probably damaging Het
Or8k35 T C 2: 86,424,908 (GRCm39) D88G probably benign Het
Pate3 T A 9: 35,557,398 (GRCm39) H86L probably damaging Het
Pla2r1 A T 2: 60,353,217 (GRCm39) F248Y probably damaging Het
Ppp1r37 A G 7: 19,268,994 (GRCm39) S169P probably damaging Het
Pramex1 A T X: 134,514,374 (GRCm39) L305Q probably damaging Het
Prkcg G A 7: 3,375,983 (GRCm39) V492I probably damaging Het
Psmb11 T A 14: 54,863,103 (GRCm39) V107E probably damaging Het
Reg1 A G 6: 78,404,013 (GRCm39) D60G probably null Het
Shoc1 A T 4: 59,076,500 (GRCm39) V481D possibly damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Trim23 A G 13: 104,324,131 (GRCm39) T177A probably benign Het
Xkr4 A T 1: 3,491,998 (GRCm39) F308L probably benign Het
Xylt1 A G 7: 117,074,748 (GRCm39) I122V probably benign Het
Zan T C 5: 137,462,201 (GRCm39) T993A unknown Het
Zfp292 T C 4: 34,807,744 (GRCm39) I1767V probably benign Het
Zfp292 G T 4: 34,809,611 (GRCm39) S1144R possibly damaging Het
Zfp317 T G 9: 19,559,333 (GRCm39) W516G possibly damaging Het
Zfp974 G A 7: 27,611,677 (GRCm39) T16I possibly damaging Het
Other mutations in Zbtb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Zbtb20 APN 16 43,431,024 (GRCm39) missense possibly damaging 0.85
IGL02170:Zbtb20 APN 16 43,430,025 (GRCm39) missense possibly damaging 0.84
IGL02292:Zbtb20 APN 16 43,431,011 (GRCm39) nonsense probably null
IGL02733:Zbtb20 APN 16 43,430,296 (GRCm39) missense possibly damaging 0.48
IGL03277:Zbtb20 APN 16 43,438,800 (GRCm39) missense possibly damaging 0.95
siberian UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
Tiger UTSW 16 43,438,761 (GRCm39) missense probably damaging 0.98
Towering UTSW 16 43,431,230 (GRCm39) nonsense probably null
R0310:Zbtb20 UTSW 16 43,430,109 (GRCm39) missense probably damaging 0.98
R1593:Zbtb20 UTSW 16 43,429,786 (GRCm39) missense probably damaging 0.99
R1996:Zbtb20 UTSW 16 43,430,443 (GRCm39) missense probably damaging 0.98
R2018:Zbtb20 UTSW 16 43,398,015 (GRCm39) missense possibly damaging 0.86
R2050:Zbtb20 UTSW 16 43,429,975 (GRCm39) splice site probably null
R2097:Zbtb20 UTSW 16 43,429,882 (GRCm39) missense probably null 1.00
R4708:Zbtb20 UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
R4710:Zbtb20 UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
R4835:Zbtb20 UTSW 16 43,438,761 (GRCm39) missense probably damaging 0.98
R4962:Zbtb20 UTSW 16 43,439,055 (GRCm39) missense probably damaging 0.99
R5531:Zbtb20 UTSW 16 43,431,230 (GRCm39) nonsense probably null
R7452:Zbtb20 UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
R7523:Zbtb20 UTSW 16 43,430,875 (GRCm39) missense probably benign 0.01
R8175:Zbtb20 UTSW 16 43,397,443 (GRCm39) intron probably benign
R8306:Zbtb20 UTSW 16 43,439,100 (GRCm39) missense probably damaging 0.99
R8811:Zbtb20 UTSW 16 43,430,857 (GRCm39) missense probably benign
R8922:Zbtb20 UTSW 16 43,397,968 (GRCm39) missense probably damaging 0.99
R9164:Zbtb20 UTSW 16 43,430,764 (GRCm39) missense probably benign 0.02
R9687:Zbtb20 UTSW 16 43,430,160 (GRCm39) missense possibly damaging 0.83
Z1176:Zbtb20 UTSW 16 43,430,893 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GTGCAGTATCCCCAGCTTTC -3'
(R):5'- CGCTGTACATGAAGTCAATGAGC -3'

Sequencing Primer
(F):5'- TGCATCTGCCAGGTGGG -3'
(R):5'- GCTTTTGCACCGATTGTACG -3'
Posted On 2015-04-29