Incidental Mutation 'R4007:Card9'
ID311502
Institutional Source Beutler Lab
Gene Symbol Card9
Ensembl Gene ENSMUSG00000026928
Gene Namecaspase recruitment domain family, member 9
SynonymsLOC332579
MMRRC Submission 041610-MU
Accession Numbers

Ncbi RefSeq: NM_001037747; MGI:2685628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4007 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26352176-26360918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26353000 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 459 (R459W)
Ref Sequence ENSEMBL: ENSMUSP00000097876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000028295] [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000100303] [ENSMUST00000114134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028294
AA Change: R459W

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928
AA Change: R459W

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028295
SMART Domains Protein: ENSMUSP00000028295
Gene: ENSMUSG00000075467

DomainStartEndE-ValueType
low complexity region 38 67 N/A INTRINSIC
Pfam:zf-DNL 74 139 4.1e-34 PFAM
low complexity region 158 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066889
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100303
AA Change: R459W

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928
AA Change: R459W

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125848
Predicted Effect probably benign
Transcript: ENSMUST00000145884
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153370
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele of this gene display impaired immune responses to fungal infection but normal rates of bacterial clearance. However, homozygotes for a second allele display impaired bacterial clearance and impaired early innate immune responses. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aff1 A T 5: 103,784,222 K243N probably benign Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gml T A 15: 74,813,699 I146L possibly damaging Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mrps5 C A 2: 127,591,835 T48K possibly damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rpap2 A G 5: 107,603,872 I129V probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Card9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Card9 APN 2 26356862 missense probably benign
IGL02397:Card9 APN 2 26352329 missense probably damaging 1.00
IGL02506:Card9 APN 2 26354415 splice site probably benign
IGL02536:Card9 APN 2 26358832 missense possibly damaging 0.93
IGL02809:Card9 APN 2 26356864 missense probably benign 0.01
IGL02962:Card9 APN 2 26358017 critical splice acceptor site probably null
R1441:Card9 UTSW 2 26359390 missense probably benign 0.01
R1585:Card9 UTSW 2 26354386 missense probably benign 0.01
R1755:Card9 UTSW 2 26359534 missense probably damaging 0.99
R1959:Card9 UTSW 2 26354873 critical splice acceptor site probably null
R2972:Card9 UTSW 2 26357210 missense probably damaging 1.00
R4283:Card9 UTSW 2 26357297 missense possibly damaging 0.77
R4789:Card9 UTSW 2 26357620 missense probably damaging 0.99
R5381:Card9 UTSW 2 26358883 missense probably damaging 1.00
R5933:Card9 UTSW 2 26352497 missense probably damaging 1.00
R6379:Card9 UTSW 2 26356777 missense probably damaging 1.00
R7008:Card9 UTSW 2 26357799 missense possibly damaging 0.96
R7124:Card9 UTSW 2 26356884 critical splice acceptor site probably null
R7131:Card9 UTSW 2 26358835 missense probably damaging 1.00
R7171:Card9 UTSW 2 26359484 missense possibly damaging 0.78
R7237:Card9 UTSW 2 26356775 missense probably benign 0.00
R8023:Card9 UTSW 2 26357315 missense probably benign 0.00
Z1176:Card9 UTSW 2 26357796 missense probably damaging 1.00
Z1177:Card9 UTSW 2 26357551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTGTCCTTACATTGTCCC -3'
(R):5'- ATGTAGCAGTCAAGGGCTCAG -3'

Sequencing Primer
(F):5'- TGTTACATCCTACCCATACACTAC -3'
(R):5'- CTCAGCCTGTTTCTGTGAAATGCAG -3'
Posted On2015-04-29