Incidental Mutation 'R4007:Nup188'
ID311503
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Namenucleoporin 188
Synonyms
MMRRC Submission 041610-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4007 (G1)
Quality Score215
Status Validated
Chromosome2
Chromosomal Location30286397-30344266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30309878 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 305 (D305N)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447] [ENSMUST00000148969]
Predicted Effect probably damaging
Transcript: ENSMUST00000064447
AA Change: D305N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: D305N

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141035
Predicted Effect probably benign
Transcript: ENSMUST00000148969
SMART Domains Protein: ENSMUSP00000121742
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 115 1.1e-27 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aff1 A T 5: 103,784,222 K243N probably benign Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Card9 T A 2: 26,353,000 R459W possibly damaging Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gml T A 15: 74,813,699 I146L possibly damaging Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mrps5 C A 2: 127,591,835 T48K possibly damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rpap2 A G 5: 107,603,872 I129V probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30333400 missense probably damaging 0.98
IGL01599:Nup188 APN 2 30327525 missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30329359 missense probably benign
IGL01973:Nup188 APN 2 30339850 missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30329373 nonsense probably null
IGL02221:Nup188 APN 2 30330641 missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30326511 missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30323636 critical splice donor site probably null
IGL02986:Nup188 APN 2 30307633 unclassified probably null
IGL03029:Nup188 APN 2 30322580 splice site probably benign
IGL03194:Nup188 APN 2 30304334 missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30340641 missense possibly damaging 0.52
P0027:Nup188 UTSW 2 30322681 missense probably damaging 0.99
R0006:Nup188 UTSW 2 30322023 missense probably benign 0.27
R0360:Nup188 UTSW 2 30326479 missense probably null 0.93
R0373:Nup188 UTSW 2 30330988 missense probably damaging 1.00
R0645:Nup188 UTSW 2 30343466 unclassified probably null
R1411:Nup188 UTSW 2 30343795 missense probably benign 0.01
R1670:Nup188 UTSW 2 30340655 missense probably benign 0.19
R2034:Nup188 UTSW 2 30310085 unclassified probably benign
R2113:Nup188 UTSW 2 30304101 nonsense probably null
R2142:Nup188 UTSW 2 30336706 missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30336924 splice site probably benign
R2567:Nup188 UTSW 2 30341782 missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30325346 missense probably damaging 0.98
R4006:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4079:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4480:Nup188 UTSW 2 30322129 intron probably benign
R4628:Nup188 UTSW 2 30329346 missense probably damaging 1.00
R4687:Nup188 UTSW 2 30330633 missense probably benign 0.01
R4814:Nup188 UTSW 2 30326511 missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30339584 missense probably damaging 1.00
R5038:Nup188 UTSW 2 30309220 missense probably damaging 0.98
R5056:Nup188 UTSW 2 30304131 missense probably damaging 0.98
R5124:Nup188 UTSW 2 30330935 missense probably damaging 1.00
R5256:Nup188 UTSW 2 30330749 missense probably damaging 1.00
R5284:Nup188 UTSW 2 30330635 missense probably damaging 1.00
R5548:Nup188 UTSW 2 30326493 missense probably damaging 0.99
R5560:Nup188 UTSW 2 30309885 missense probably damaging 0.99
R5668:Nup188 UTSW 2 30336324 missense probably damaging 1.00
R5769:Nup188 UTSW 2 30330735 missense probably benign 0.34
R5773:Nup188 UTSW 2 30322196 missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30301048 missense probably damaging 1.00
R5827:Nup188 UTSW 2 30339847 missense probably damaging 1.00
R5919:Nup188 UTSW 2 30339894 missense probably damaging 1.00
R5923:Nup188 UTSW 2 30304090 missense probably benign
R6185:Nup188 UTSW 2 30341710 missense probably damaging 0.97
R6457:Nup188 UTSW 2 30322187 missense probably damaging 0.98
R6529:Nup188 UTSW 2 30326454 missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30323568 missense probably damaging 0.99
R7195:Nup188 UTSW 2 30341830 critical splice donor site probably null
R7214:Nup188 UTSW 2 30307554 missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30340601 missense probably benign 0.09
T0722:Nup188 UTSW 2 30322681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTTGGGTTCCTAGCAAG -3'
(R):5'- CTTGCCGTCATGCCAACTAC -3'

Sequencing Primer
(F):5'- TCCTAGCAAGGTGGTCGAG -3'
(R):5'- ACATCATTTCCTCCACTGGCAAG -3'
Posted On2015-04-29