Mutagenetix > Incidental Mutations

Incidental Mutation 'R4007:Mrps5'

311507

Institutional Source

Beutler Lab

Gene Symbol

Mrps5

Ensembl Gene

ENSMUSG00000027374

Gene Name

mitochondrial ribosomal protein S5

Synonyms

MMRRC Submission

041610-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4007 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127587222-127606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 127591835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 48 (T48K)

Ref Sequence

ENSEMBL: ENSMUSP00000119674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028852] [ENSMUST00000110366] [ENSMUST00000146131]

AlphaFold

Q99N87

Predicted Effect

probably benign
Transcript: ENSMUST00000028852
AA Change: T56K

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: T56K

Domain	Start	End	E-Value	Type
low complexity region	108	126	N/A	INTRINSIC
Pfam:Ribosomal_S5	220	285	3.5e-20	PFAM
Pfam:Ribosomal_S5_C	297	368	4.7e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110366

SMART Domains

Protein: ENSMUSP00000105995
Gene: ENSMUSG00000034800

Domain	Start	End	E-Value	Type
KRAB	14	74	1.33e-28	SMART
ZnF_C2H2	169	191	1.12e-3	SMART
ZnF_C2H2	197	219	6.42e-4	SMART
ZnF_C2H2	225	247	7.37e-4	SMART
ZnF_C2H2	253	275	9.22e-5	SMART
ZnF_C2H2	281	303	9.73e-4	SMART
ZnF_C2H2	309	331	1.04e-3	SMART
ZnF_C2H2	337	359	5.67e-5	SMART
ZnF_C2H2	365	387	5.99e-4	SMART
ZnF_C2H2	393	413	4.94e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126491

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134101

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146131
AA Change: T48K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000119674
Gene: ENSMUSG00000027374
AA Change: T48K

Domain	Start	End	E-Value	Type
low complexity region	100	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	T	C	19: 31,918,124		probably null	Het
Aff1	A	T	5: 103,784,222	K243N	probably benign	Het
Aknad1	T	C	3: 108,775,282	I558T	probably benign	Het
Ampd1	A	G	3: 103,092,460	I460V	probably damaging	Het
Atp10b	A	T	11: 43,259,852	H1459L	probably benign	Het
Card9	T	A	2: 26,353,000	R459W	possibly damaging	Het
Chd3	A	T	11: 69,349,001	I1667N	probably benign	Het
Col6a3	A	G	1: 90,802,569	S1672P	probably damaging	Het
Cul4a	A	G	8: 13,122,859	N164S	probably benign	Het
Dhx37	G	A	5: 125,424,931		probably benign	Het
Dnah1	T	C	14: 31,303,784		probably benign	Het
Erbb4	C	A	1: 68,740,401	R72L	probably damaging	Het
F11r	A	G	1: 171,461,348	K178R	probably benign	Het
Fan1	A	G	7: 64,366,561	L605P	probably damaging	Het
Fcna	A	G	2: 25,626,006		probably null	Het
Filip1	A	G	9: 79,818,727	I870T	possibly damaging	Het
Gm11595	C	T	11: 99,772,035	C273Y	unknown	Het
Gml	T	A	15: 74,813,699	I146L	possibly damaging	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Htr2a	A	T	14: 74,642,141	H70L	probably benign	Het
Ifitm6	T	A	7: 141,016,714	I69F	possibly damaging	Het
Ikbkap	G	A	4: 56,794,139	T168I	probably damaging	Het
Iqsec3	A	G	6: 121,376,228	S1144P	probably damaging	Het
Kazn	T	C	4: 142,106,892	T618A	unknown	Het
Mst1	A	G	9: 108,082,948	E377G	possibly damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Olfr1082	T	C	2: 86,594,564	D88G	probably benign	Het
Opn4	A	T	14: 34,599,832	S43T	probably benign	Het
Plcb2	T	C	2: 118,710,793	E1021G	probably damaging	Het
Prame	A	T	X: 135,613,625	L305Q	probably damaging	Het
Rbsn	T	A	6: 92,189,819	T615S	probably benign	Het
Reg1	A	G	6: 78,427,030	D60G	probably null	Het
Ros1	A	T	10: 52,118,232	D1317E	probably damaging	Het
Rpap2	A	G	5: 107,603,872	I129V	probably damaging	Het
Rubcnl	G	T	14: 75,049,703	V604L	possibly damaging	Het
Slc26a4	T	A	12: 31,540,533	K374*	probably null	Het
Slc4a4	T	A	5: 89,214,593	S854R	probably damaging	Het
Sv2c	A	G	13: 95,986,833		probably benign	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tnik	A	G	3: 28,604,281	S572G	probably damaging	Het
Trbv13-3	T	C	6: 41,130,186	C14R	probably benign	Het
Ttc7	G	A	17: 87,290,251	D84N	possibly damaging	Het
Ubtd1	G	T	19: 42,032,116	G100*	probably null	Het
Vmn2r18	A	T	5: 151,585,246	W138R	probably damaging	Het
Zan	T	C	5: 137,463,939	T993A	unknown	Het
Zfp385b	C	T	2: 77,719,492	G83D	probably benign	Het
Zfp493	A	G	13: 67,783,919		probably benign	Het

Other mutations in Mrps5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01968:Mrps5	APN	2	127591907	missense	probably null	0.01
IGL03348:Mrps5	APN	2	127601385	missense	probably damaging	0.98
R0369:Mrps5	UTSW	2	127591829	missense	probably benign	0.09
R0485:Mrps5	UTSW	2	127591825	missense	possibly damaging	0.56
R0622:Mrps5	UTSW	2	127594531	missense	probably benign	0.00
R1954:Mrps5	UTSW	2	127596897	splice site	probably null
R2182:Mrps5	UTSW	2	127602487	missense	probably damaging	1.00
R3414:Mrps5	UTSW	2	127596912	missense	probably benign	0.38
R4687:Mrps5	UTSW	2	127590770	missense	probably benign	0.44
R4780:Mrps5	UTSW	2	127598241	missense	probably benign	0.00
R4835:Mrps5	UTSW	2	127603707	missense	possibly damaging	0.84
R4851:Mrps5	UTSW	2	127590745	missense	probably benign	0.00
R5076:Mrps5	UTSW	2	127600852	nonsense	probably null
R5558:Mrps5	UTSW	2	127602435	missense	probably damaging	1.00
R6192:Mrps5	UTSW	2	127601385	missense	probably damaging	0.98
R7038:Mrps5	UTSW	2	127600866	missense	probably damaging	1.00
R7071:Mrps5	UTSW	2	127600852	nonsense	probably null
R7103:Mrps5	UTSW	2	127601410	missense	probably damaging	0.99
R7177:Mrps5	UTSW	2	127595697	missense	probably benign
R7319:Mrps5	UTSW	2	127595842	missense	possibly damaging	0.94
R7387:Mrps5	UTSW	2	127600884	missense	probably damaging	1.00
R7460:Mrps5	UTSW	2	127591891	missense	not run
R8211:Mrps5	UTSW	2	127603724	missense	probably benign
R9358:Mrps5	UTSW	2	127595814	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TGAAAATGTCTCGAATTTTGTTGTTG -3'
(R):5'- ACAAACACATTCCATTTTCTGGT -3'

Sequencing Primer
(F):5'- TCAAACTCAGGTTGTCAGGC -3'
(R):5'- CCATTTTCTGGTTCCATGAAAAGGG -3'

Posted On

2015-04-29