Incidental Mutation 'R4007:Mrps5'
ID 311507
Institutional Source Beutler Lab
Gene Symbol Mrps5
Ensembl Gene ENSMUSG00000027374
Gene Name mitochondrial ribosomal protein S5
Synonyms
MMRRC Submission 041610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4007 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 127587222-127606829 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 127591835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 48 (T48K)
Ref Sequence ENSEMBL: ENSMUSP00000119674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028852] [ENSMUST00000110366] [ENSMUST00000146131]
AlphaFold Q99N87
Predicted Effect probably benign
Transcript: ENSMUST00000028852
AA Change: T56K

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: T56K

DomainStartEndE-ValueType
low complexity region 108 126 N/A INTRINSIC
Pfam:Ribosomal_S5 220 285 3.5e-20 PFAM
Pfam:Ribosomal_S5_C 297 368 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110366
SMART Domains Protein: ENSMUSP00000105995
Gene: ENSMUSG00000034800

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134101
Predicted Effect possibly damaging
Transcript: ENSMUST00000146131
AA Change: T48K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119674
Gene: ENSMUSG00000027374
AA Change: T48K

DomainStartEndE-ValueType
low complexity region 100 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aff1 A T 5: 103,784,222 K243N probably benign Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Card9 T A 2: 26,353,000 R459W possibly damaging Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gml T A 15: 74,813,699 I146L possibly damaging Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rpap2 A G 5: 107,603,872 I129V probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Mrps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Mrps5 APN 2 127591907 missense probably null 0.01
IGL03348:Mrps5 APN 2 127601385 missense probably damaging 0.98
R0369:Mrps5 UTSW 2 127591829 missense probably benign 0.09
R0485:Mrps5 UTSW 2 127591825 missense possibly damaging 0.56
R0622:Mrps5 UTSW 2 127594531 missense probably benign 0.00
R1954:Mrps5 UTSW 2 127596897 splice site probably null
R2182:Mrps5 UTSW 2 127602487 missense probably damaging 1.00
R3414:Mrps5 UTSW 2 127596912 missense probably benign 0.38
R4687:Mrps5 UTSW 2 127590770 missense probably benign 0.44
R4780:Mrps5 UTSW 2 127598241 missense probably benign 0.00
R4835:Mrps5 UTSW 2 127603707 missense possibly damaging 0.84
R4851:Mrps5 UTSW 2 127590745 missense probably benign 0.00
R5076:Mrps5 UTSW 2 127600852 nonsense probably null
R5558:Mrps5 UTSW 2 127602435 missense probably damaging 1.00
R6192:Mrps5 UTSW 2 127601385 missense probably damaging 0.98
R7038:Mrps5 UTSW 2 127600866 missense probably damaging 1.00
R7071:Mrps5 UTSW 2 127600852 nonsense probably null
R7103:Mrps5 UTSW 2 127601410 missense probably damaging 0.99
R7177:Mrps5 UTSW 2 127595697 missense probably benign
R7319:Mrps5 UTSW 2 127595842 missense possibly damaging 0.94
R7387:Mrps5 UTSW 2 127600884 missense probably damaging 1.00
R7460:Mrps5 UTSW 2 127591891 missense not run
R8211:Mrps5 UTSW 2 127603724 missense probably benign
R9358:Mrps5 UTSW 2 127595814 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGAAAATGTCTCGAATTTTGTTGTTG -3'
(R):5'- ACAAACACATTCCATTTTCTGGT -3'

Sequencing Primer
(F):5'- TCAAACTCAGGTTGTCAGGC -3'
(R):5'- CCATTTTCTGGTTCCATGAAAAGGG -3'
Posted On 2015-04-29