Incidental Mutation 'R4007:Aff1'
ID311515
Institutional Source Beutler Lab
Gene Symbol Aff1
Ensembl Gene ENSMUSG00000029313
Gene NameAF4/FMR2 family, member 1
Synonyms9630032B01Rik, Af4, Rob, Mllt2h
MMRRC Submission 041610-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R4007 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location103692374-103855322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103784222 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 243 (K243N)
Ref Sequence ENSEMBL: ENSMUSP00000119631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]
Predicted Effect probably benign
Transcript: ENSMUST00000031256
AA Change: K243N

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: K243N

DomainStartEndE-ValueType
Pfam:AF-4 16 1223 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054979
AA Change: K235N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: K235N

DomainStartEndE-ValueType
Pfam:AF-4 8 1216 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152145
Predicted Effect probably benign
Transcript: ENSMUST00000153165
AA Change: K243N

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313
AA Change: K243N

DomainStartEndE-ValueType
Pfam:AF-4 16 871 N/A PFAM
Meta Mutation Damage Score 0.1194 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Card9 T A 2: 26,353,000 R459W possibly damaging Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gml T A 15: 74,813,699 I146L possibly damaging Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mrps5 C A 2: 127,591,835 T48K possibly damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rpap2 A G 5: 107,603,872 I129V probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Aff1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Aff1 APN 5 103784077 missense probably damaging 1.00
IGL02060:Aff1 APN 5 103783849 missense possibly damaging 0.51
IGL02081:Aff1 APN 5 103834305 missense probably damaging 1.00
IGL02108:Aff1 APN 5 103811109 critical splice donor site probably null
IGL03056:Aff1 APN 5 103811081 missense probably damaging 0.99
IGL03332:Aff1 APN 5 103841105 nonsense probably null
IGL03340:Aff1 APN 5 103783804 missense possibly damaging 0.76
IGL03382:Aff1 APN 5 103841060 missense possibly damaging 0.86
PIT4495001:Aff1 UTSW 5 103849525 missense probably benign 0.16
R0013:Aff1 UTSW 5 103828484 nonsense probably null
R0219:Aff1 UTSW 5 103811040 splice site probably benign
R0520:Aff1 UTSW 5 103847751 nonsense probably null
R0607:Aff1 UTSW 5 103828454 missense probably damaging 1.00
R0883:Aff1 UTSW 5 103826138 splice site probably benign
R1662:Aff1 UTSW 5 103841057 missense probably damaging 0.99
R1730:Aff1 UTSW 5 103833512 missense probably damaging 1.00
R1850:Aff1 UTSW 5 103833907 missense probably damaging 1.00
R3411:Aff1 UTSW 5 103754706 start codon destroyed probably null 0.53
R4207:Aff1 UTSW 5 103818988 critical splice donor site probably null
R4702:Aff1 UTSW 5 103811069 missense probably damaging 1.00
R4730:Aff1 UTSW 5 103843073 missense possibly damaging 0.95
R4784:Aff1 UTSW 5 103847039 nonsense probably null
R5166:Aff1 UTSW 5 103754657 start gained probably benign
R5294:Aff1 UTSW 5 103811157 intron probably benign
R5435:Aff1 UTSW 5 103754332 unclassified probably benign
R5436:Aff1 UTSW 5 103783870 missense probably damaging 1.00
R6065:Aff1 UTSW 5 103842252 missense probably damaging 1.00
R6114:Aff1 UTSW 5 103842297 missense probably damaging 0.97
R6298:Aff1 UTSW 5 103754720 missense possibly damaging 0.68
R7095:Aff1 UTSW 5 103843085 missense probably damaging 0.97
R7261:Aff1 UTSW 5 103828379 missense probably damaging 0.97
R7350:Aff1 UTSW 5 103847092 missense probably benign 0.28
R7423:Aff1 UTSW 5 103847101 missense probably damaging 1.00
R7469:Aff1 UTSW 5 103833547 missense probably benign 0.00
R7604:Aff1 UTSW 5 103847809 missense probably benign 0.09
R7607:Aff1 UTSW 5 103849459 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGAGCTGAAGGAGACTCTGC -3'
(R):5'- TGACCATAGTCCTCCAGTGG -3'

Sequencing Primer
(F):5'- AAGGAGACTCTGCTCCCGAGAG -3'
(R):5'- ATAGTCCTCCAGTGGCAGCTTC -3'
Posted On2015-04-29