Incidental Mutation 'R4007:Rpap2'
ID311516
Institutional Source Beutler Lab
Gene Symbol Rpap2
Ensembl Gene ENSMUSG00000033773
Gene NameRNA polymerase II associated protein 2
Synonyms
MMRRC Submission 041610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4007 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107597373-107661838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107603872 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 129 (I129V)
Ref Sequence ENSEMBL: ENSMUSP00000108274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065422] [ENSMUST00000112650] [ENSMUST00000112651] [ENSMUST00000112654] [ENSMUST00000112655] [ENSMUST00000129483] [ENSMUST00000150074]
Predicted Effect probably damaging
Transcript: ENSMUST00000065422
AA Change: I129V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070209
Gene: ENSMUSG00000033773
AA Change: I129V

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 80 152 3.6e-26 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112650
AA Change: I50V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108269
Gene: ENSMUSG00000033773
AA Change: I50V

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 1.7e-28 PFAM
low complexity region 129 142 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112651
AA Change: I52V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108270
Gene: ENSMUSG00000033773
AA Change: I52V

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 76 1.9e-28 PFAM
low complexity region 131 144 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 482 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112654
AA Change: I129V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108273
Gene: ENSMUSG00000033773
AA Change: I129V

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 1.8e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112655
AA Change: I129V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108274
Gene: ENSMUSG00000033773
AA Change: I129V

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 4.1e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129483
AA Change: I50V

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142510
Gene: ENSMUSG00000033773
AA Change: I50V

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 5.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147284
Predicted Effect probably benign
Transcript: ENSMUST00000150074
Meta Mutation Damage Score 0.1743 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aff1 A T 5: 103,784,222 K243N probably benign Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Card9 T A 2: 26,353,000 R459W possibly damaging Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gml T A 15: 74,813,699 I146L possibly damaging Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mrps5 C A 2: 127,591,835 T48K possibly damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Rpap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rpap2 APN 5 107603631 unclassified probably benign
IGL01451:Rpap2 APN 5 107603626 critical splice donor site probably null
IGL01583:Rpap2 APN 5 107620195 missense probably damaging 0.99
IGL01837:Rpap2 APN 5 107625969 critical splice donor site probably null
IGL02343:Rpap2 APN 5 107618181 splice site probably null
IGL02999:Rpap2 APN 5 107601831 missense possibly damaging 0.61
IGL03261:Rpap2 APN 5 107598560 missense possibly damaging 0.95
IGL03381:Rpap2 APN 5 107620201 missense probably benign 0.00
R0077:Rpap2 UTSW 5 107620474 missense probably damaging 1.00
R1698:Rpap2 UTSW 5 107603550 missense probably damaging 1.00
R1897:Rpap2 UTSW 5 107633095 missense possibly damaging 0.85
R3039:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R3605:Rpap2 UTSW 5 107620529 missense probably damaging 1.00
R3735:Rpap2 UTSW 5 107655151 splice site probably benign
R4367:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4448:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4589:Rpap2 UTSW 5 107620495 missense probably benign 0.00
R4606:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4799:Rpap2 UTSW 5 107620247 missense probably benign 0.00
R4939:Rpap2 UTSW 5 107603625 critical splice donor site probably null
R5580:Rpap2 UTSW 5 107620145 missense probably benign 0.12
R6003:Rpap2 UTSW 5 107601901 unclassified probably null
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6142:Rpap2 UTSW 5 107598298 missense probably benign
R6161:Rpap2 UTSW 5 107620670 missense probably damaging 1.00
R6687:Rpap2 UTSW 5 107603630 splice site probably null
R6761:Rpap2 UTSW 5 107620238 missense probably benign
R6783:Rpap2 UTSW 5 107655287 missense probably damaging 0.99
R7106:Rpap2 UTSW 5 107633122 nonsense probably null
R7314:Rpap2 UTSW 5 107620379 missense probably damaging 0.96
R7402:Rpap2 UTSW 5 107620458 nonsense probably null
R7644:Rpap2 UTSW 5 107620301 missense probably benign 0.04
R7782:Rpap2 UTSW 5 107620192 missense probably benign 0.08
R7890:Rpap2 UTSW 5 107606911 missense probably damaging 1.00
R7973:Rpap2 UTSW 5 107606911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCACAGAGTAGTAAGTTAAGCCTG -3'
(R):5'- CACCCAGCTTCAAGTCTTATTAAAGC -3'

Sequencing Primer
(F):5'- AGTTAAGCCTGTGGTCATGAAC -3'
(R):5'- GCTTCAAGTCTTATTAAAGCTCAAGC -3'
Posted On2015-04-29