Incidental Mutation 'R4007:Sv2c'
ID 311538
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 041610-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4007 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 96123341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably benign
Transcript: ENSMUST00000161263
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably benign
Transcript: ENSMUST00000182289
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,895,524 (GRCm39) probably null Het
Aff1 A T 5: 103,932,088 (GRCm39) K243N probably benign Het
Aknad1 T C 3: 108,682,598 (GRCm39) I558T probably benign Het
Ampd1 A G 3: 102,999,776 (GRCm39) I460V probably damaging Het
Atp10b A T 11: 43,150,679 (GRCm39) H1459L probably benign Het
Card9 T A 2: 26,243,012 (GRCm39) R459W possibly damaging Het
Chd3 A T 11: 69,239,827 (GRCm39) I1667N probably benign Het
Col6a3 A G 1: 90,730,291 (GRCm39) S1672P probably damaging Het
Cul4a A G 8: 13,172,859 (GRCm39) N164S probably benign Het
Dhx37 G A 5: 125,501,995 (GRCm39) probably benign Het
Dnah1 T C 14: 31,025,741 (GRCm39) probably benign Het
Elp1 G A 4: 56,794,139 (GRCm39) T168I probably damaging Het
Erbb4 C A 1: 68,779,560 (GRCm39) R72L probably damaging Het
F11r A G 1: 171,288,916 (GRCm39) K178R probably benign Het
Fan1 A G 7: 64,016,309 (GRCm39) L605P probably damaging Het
Fcna A G 2: 25,516,018 (GRCm39) probably null Het
Filip1 A G 9: 79,726,009 (GRCm39) I870T possibly damaging Het
Gm11595 C T 11: 99,662,861 (GRCm39) C273Y unknown Het
Gml T A 15: 74,685,548 (GRCm39) I146L possibly damaging Het
Gprc5b G A 7: 118,583,437 (GRCm39) A144V possibly damaging Het
Htr2a A T 14: 74,879,581 (GRCm39) H70L probably benign Het
Ifitm6 T A 7: 140,596,627 (GRCm39) I69F possibly damaging Het
Iqsec3 A G 6: 121,353,187 (GRCm39) S1144P probably damaging Het
Kazn T C 4: 141,834,203 (GRCm39) T618A unknown Het
Mrps5 C A 2: 127,433,755 (GRCm39) T48K possibly damaging Het
Mst1 A G 9: 107,960,147 (GRCm39) E377G possibly damaging Het
Nup188 G A 2: 30,199,890 (GRCm39) D305N probably damaging Het
Opn4 A T 14: 34,321,789 (GRCm39) S43T probably benign Het
Or8k35 T C 2: 86,424,908 (GRCm39) D88G probably benign Het
Plcb2 T C 2: 118,541,274 (GRCm39) E1021G probably damaging Het
Pramex1 A T X: 134,514,374 (GRCm39) L305Q probably damaging Het
Rbsn T A 6: 92,166,800 (GRCm39) T615S probably benign Het
Reg1 A G 6: 78,404,013 (GRCm39) D60G probably null Het
Ros1 A T 10: 51,994,328 (GRCm39) D1317E probably damaging Het
Rpap2 A G 5: 107,751,738 (GRCm39) I129V probably damaging Het
Rubcnl G T 14: 75,287,143 (GRCm39) V604L possibly damaging Het
Slc26a4 T A 12: 31,590,532 (GRCm39) K374* probably null Het
Slc4a4 T A 5: 89,362,452 (GRCm39) S854R probably damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Tnik A G 3: 28,658,430 (GRCm39) S572G probably damaging Het
Trbv13-3 T C 6: 41,107,120 (GRCm39) C14R probably benign Het
Ttc7 G A 17: 87,597,679 (GRCm39) D84N possibly damaging Het
Ubtd1 G T 19: 42,020,555 (GRCm39) G100* probably null Het
Vmn2r18 A T 5: 151,508,711 (GRCm39) W138R probably damaging Het
Zan T C 5: 137,462,201 (GRCm39) T993A unknown Het
Zfp385b C T 2: 77,549,836 (GRCm39) G83D probably benign Het
Zfp493 A G 13: 67,932,038 (GRCm39) probably benign Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGACACTTCCTCCTCATTG -3'
(R):5'- GGCATCTCCCTCACTAAATTGG -3'

Sequencing Primer
(F):5'- TGGAAAGTCATAGTCAGTCCCTC -3'
(R):5'- GGTTCAATTCCTTTAGATGGCC -3'
Posted On 2015-04-29