Incidental Mutation 'R4007:Htr2a'
ID311541
Institutional Source Beutler Lab
Gene Symbol Htr2a
Ensembl Gene ENSMUSG00000034997
Gene Name5-hydroxytryptamine (serotonin) receptor 2A
SynonymsHtr2, 5-HT2A receptor, Htr-2
MMRRC Submission 041610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4007 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location74640840-74709494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74642141 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 70 (H70L)
Ref Sequence ENSEMBL: ENSMUSP00000047774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036653]
Predicted Effect probably benign
Transcript: ENSMUST00000036653
AA Change: H70L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047774
Gene: ENSMUSG00000034997
AA Change: H70L

DomainStartEndE-ValueType
Pfam:7tm_4 81 264 1.2e-9 PFAM
Pfam:7TM_GPCR_Srx 82 289 1e-6 PFAM
Pfam:7TM_GPCR_Srsx 85 395 1.1e-16 PFAM
Pfam:7tm_1 91 380 5.9e-70 PFAM
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show altered anxiety-related responses and increased vertical activity. Mice homozygous for a different knock-out allele exhibit abnormal enterocyte, Paneth cell and smooth muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aff1 A T 5: 103,784,222 K243N probably benign Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Card9 T A 2: 26,353,000 R459W possibly damaging Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gml T A 15: 74,813,699 I146L possibly damaging Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mrps5 C A 2: 127,591,835 T48K possibly damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rpap2 A G 5: 107,603,872 I129V probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Htr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Htr2a APN 14 74706205 missense possibly damaging 0.93
IGL00946:Htr2a APN 14 74706142 nonsense probably null
IGL01660:Htr2a APN 14 74705754 missense probably damaging 1.00
IGL02200:Htr2a APN 14 74706165 missense probably damaging 1.00
IGL02369:Htr2a APN 14 74706282 missense probably benign 0.17
IGL02724:Htr2a APN 14 74645062 missense probably damaging 1.00
IGL02887:Htr2a APN 14 74645143 missense probably benign 0.05
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0117:Htr2a UTSW 14 74645093 missense probably damaging 1.00
R0367:Htr2a UTSW 14 74642209 missense probably damaging 1.00
R0513:Htr2a UTSW 14 74706324 missense probably benign 0.00
R0729:Htr2a UTSW 14 74642147 missense probably benign
R1507:Htr2a UTSW 14 74705979 missense probably damaging 1.00
R1522:Htr2a UTSW 14 74705853 nonsense probably null
R1539:Htr2a UTSW 14 74645168 missense possibly damaging 0.66
R1735:Htr2a UTSW 14 74706128 missense probably damaging 1.00
R1747:Htr2a UTSW 14 74706153 missense probably damaging 1.00
R1854:Htr2a UTSW 14 74705753 missense probably damaging 1.00
R2232:Htr2a UTSW 14 74645029 missense probably damaging 1.00
R2348:Htr2a UTSW 14 74645110 missense probably damaging 1.00
R3154:Htr2a UTSW 14 74705822 missense probably benign 0.00
R3401:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4006:Htr2a UTSW 14 74642141 missense probably benign
R4093:Htr2a UTSW 14 74706349 missense probably benign
R4094:Htr2a UTSW 14 74706349 missense probably benign
R4095:Htr2a UTSW 14 74706349 missense probably benign
R4502:Htr2a UTSW 14 74641988 missense probably benign 0.02
R4720:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4932:Htr2a UTSW 14 74642022 missense probably benign
R5651:Htr2a UTSW 14 74705703 missense probably damaging 0.98
R5935:Htr2a UTSW 14 74645090 missense probably damaging 1.00
R6175:Htr2a UTSW 14 74645034 nonsense probably null
R6937:Htr2a UTSW 14 74645164 missense probably damaging 0.98
R7138:Htr2a UTSW 14 74705742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGGCTTAGACATGGAAATTC -3'
(R):5'- AACATGGACACGGGCATGAC -3'

Sequencing Primer
(F):5'- CTCTGTGAAGACAATATCTCCCTGAG -3'
(R):5'- CGGGCATGACAAGGAAACCC -3'
Posted On2015-04-29