Incidental Mutation 'R4007:Gml'
ID311544
Institutional Source Beutler Lab
Gene Symbol Gml
Ensembl Gene ENSMUSG00000068349
Gene Nameglycosylphosphatidylinositol anchored molecule like
SynonymsEG625599
MMRRC Submission 041610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4007 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74813452-74818815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74813699 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 146 (I146L)
Ref Sequence ENSEMBL: ENSMUSP00000128174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096400] [ENSMUST00000164026] [ENSMUST00000185253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096400
AA Change: I146L

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094131
Gene: ENSMUSG00000068349
AA Change: I146L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164026
AA Change: I146L

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128174
Gene: ENSMUSG00000068349
AA Change: I146L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185253
SMART Domains Protein: ENSMUSP00000140245
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UPAR_LY6 49 104 3.8e-3 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,918,124 probably null Het
Aff1 A T 5: 103,784,222 K243N probably benign Het
Aknad1 T C 3: 108,775,282 I558T probably benign Het
Ampd1 A G 3: 103,092,460 I460V probably damaging Het
Atp10b A T 11: 43,259,852 H1459L probably benign Het
Card9 T A 2: 26,353,000 R459W possibly damaging Het
Chd3 A T 11: 69,349,001 I1667N probably benign Het
Col6a3 A G 1: 90,802,569 S1672P probably damaging Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dhx37 G A 5: 125,424,931 probably benign Het
Dnah1 T C 14: 31,303,784 probably benign Het
Erbb4 C A 1: 68,740,401 R72L probably damaging Het
F11r A G 1: 171,461,348 K178R probably benign Het
Fan1 A G 7: 64,366,561 L605P probably damaging Het
Fcna A G 2: 25,626,006 probably null Het
Filip1 A G 9: 79,818,727 I870T possibly damaging Het
Gm11595 C T 11: 99,772,035 C273Y unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Ifitm6 T A 7: 141,016,714 I69F possibly damaging Het
Ikbkap G A 4: 56,794,139 T168I probably damaging Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Kazn T C 4: 142,106,892 T618A unknown Het
Mrps5 C A 2: 127,591,835 T48K possibly damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Opn4 A T 14: 34,599,832 S43T probably benign Het
Plcb2 T C 2: 118,710,793 E1021G probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Rbsn T A 6: 92,189,819 T615S probably benign Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Ros1 A T 10: 52,118,232 D1317E probably damaging Het
Rpap2 A G 5: 107,603,872 I129V probably damaging Het
Rubcnl G T 14: 75,049,703 V604L possibly damaging Het
Slc26a4 T A 12: 31,540,533 K374* probably null Het
Slc4a4 T A 5: 89,214,593 S854R probably damaging Het
Sv2c A G 13: 95,986,833 probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tnik A G 3: 28,604,281 S572G probably damaging Het
Trbv13-3 T C 6: 41,130,186 C14R probably benign Het
Ttc7 G A 17: 87,290,251 D84N possibly damaging Het
Ubtd1 G T 19: 42,032,116 G100* probably null Het
Vmn2r18 A T 5: 151,585,246 W138R probably damaging Het
Zan T C 5: 137,463,939 T993A unknown Het
Zfp385b C T 2: 77,719,492 G83D probably benign Het
Zfp493 A G 13: 67,783,919 probably benign Het
Other mutations in Gml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Gml APN 15 74813727 missense probably benign 0.00
IGL01161:Gml APN 15 74813839 missense probably damaging 1.00
IGL02415:Gml APN 15 74816440 nonsense probably null
R0674:Gml UTSW 15 74813860 missense probably damaging 1.00
R1716:Gml UTSW 15 74813816 missense possibly damaging 0.81
R1757:Gml UTSW 15 74813613 unclassified probably benign
R1827:Gml UTSW 15 74816431 missense probably benign 0.00
R1941:Gml UTSW 15 74817171 missense probably damaging 0.99
R3783:Gml UTSW 15 74813672 missense probably damaging 0.98
R5326:Gml UTSW 15 74816450 missense probably damaging 1.00
R7378:Gml UTSW 15 74817121 missense possibly damaging 0.89
R7790:Gml UTSW 15 74813613 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAAAAGGTGCTCTTGACACTG -3'
(R):5'- TGTAGGTGTGAACCTTCGGC -3'

Sequencing Primer
(F):5'- AAAGGTGCTCTTGACACTGTCTCTG -3'
(R):5'- GGCTGCTCTATGTCTACAAGCAC -3'
Posted On2015-04-29