Incidental Mutation 'R4008:Smg5'
ID311558
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene NameSmg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 040946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4008 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88336260-88362338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88349158 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 244 (S244P)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451]
Predicted Effect probably benign
Transcript: ENSMUST00000001451
AA Change: S244P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: S244P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193097
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Batf2 G A 19: 6,171,348 E63K probably damaging Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Clvs2 G A 10: 33,543,462 H199Y probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
H2-K1 G A 17: 33,999,551 probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Larp7 T C 3: 127,540,870 D490G probably benign Het
Map9 T C 3: 82,359,083 Y12H probably damaging Het
Mn1 G T 5: 111,420,169 E668D probably benign Het
Mrps18c T C 5: 100,803,116 probably benign Het
Npdc1 T A 2: 25,408,980 Y237* probably null Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr722 A G 14: 49,895,007 L265P probably benign Het
Oprm1 A G 10: 6,832,520 M388V probably benign Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Pwp1 A G 10: 85,882,034 T279A possibly damaging Het
Rabep2 C A 7: 126,445,374 D547E probably damaging Het
Rbm34 T C 8: 126,949,287 K426R probably benign Het
Rgs14 T G 13: 55,369,913 L8V probably damaging Het
Ripor2 A G 13: 24,696,538 H407R probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc39a12 T C 2: 14,452,117 F603L probably damaging Het
St3gal3 T C 4: 117,940,440 I252V probably benign Het
Tarsl2 T A 7: 65,678,128 D528E probably damaging Het
Try10 A G 6: 41,356,674 T118A probably benign Het
Tshr C T 12: 91,537,494 S402L probably benign Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88351428 nonsense probably null
IGL00902:Smg5 APN 3 88353085 missense probably benign 0.00
IGL00990:Smg5 APN 3 88343038 critical splice donor site probably null
IGL01371:Smg5 APN 3 88359644 unclassified probably benign
IGL01536:Smg5 APN 3 88349245 missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88352998 missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88346452 nonsense probably null
R0013:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0129:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0153:Smg5 UTSW 3 88353872 unclassified probably benign
R1386:Smg5 UTSW 3 88355671 missense probably damaging 1.00
R1941:Smg5 UTSW 3 88345380 missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88351561 missense probably benign
R2282:Smg5 UTSW 3 88345398 missense probably benign 0.02
R3615:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R3616:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4687:Smg5 UTSW 3 88342469 missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88355692 nonsense probably null
R4802:Smg5 UTSW 3 88355692 nonsense probably null
R4977:Smg5 UTSW 3 88355725 nonsense probably null
R5384:Smg5 UTSW 3 88351293 missense probably damaging 1.00
R5443:Smg5 UTSW 3 88354589 missense probably damaging 0.99
R5779:Smg5 UTSW 3 88351618 unclassified probably benign
R5860:Smg5 UTSW 3 88342907 missense probably damaging 0.97
R6080:Smg5 UTSW 3 88351509 missense probably benign
R6263:Smg5 UTSW 3 88341901 missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88351220 missense probably benign 0.00
R6722:Smg5 UTSW 3 88353025 missense probably damaging 0.99
R6847:Smg5 UTSW 3 88342552 missense probably damaging 1.00
R6950:Smg5 UTSW 3 88349269 critical splice donor site probably null
R7091:Smg5 UTSW 3 88351347 missense probably benign 0.00
R7395:Smg5 UTSW 3 88361071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTGCCCTCTTCTACACTGAG -3'
(R):5'- GAGTGTTTCCACAGTCCCTG -3'

Sequencing Primer
(F):5'- TGCCCTCTTCTACACTGAGAGGAG -3'
(R):5'- ACAGTCCCTGTGGTCCCAC -3'
Posted On2015-04-29