Incidental Mutation 'R4008:Rabep2'
ID311568
Institutional Source Beutler Lab
Gene Symbol Rabep2
Ensembl Gene ENSMUSG00000030727
Gene Namerabaptin, RAB GTPase binding effector protein 2
Synonyms
MMRRC Submission 040946-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R4008 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126428759-126449245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 126445374 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 547 (D547E)
Ref Sequence ENSEMBL: ENSMUSP00000102015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]
Predicted Effect probably benign
Transcript: ENSMUST00000032974
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106405
AA Change: D504E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727
AA Change: D504E

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106407
AA Change: D547E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727
AA Change: D547E

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133300
Predicted Effect probably benign
Transcript: ENSMUST00000146973
SMART Domains Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Pfam:Cation_ATPase_C 6 132 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151304
Meta Mutation Damage Score 0.0877 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Batf2 G A 19: 6,171,348 E63K probably damaging Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Clvs2 G A 10: 33,543,462 H199Y probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
H2-K1 G A 17: 33,999,551 probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Larp7 T C 3: 127,540,870 D490G probably benign Het
Map9 T C 3: 82,359,083 Y12H probably damaging Het
Mn1 G T 5: 111,420,169 E668D probably benign Het
Mrps18c T C 5: 100,803,116 probably benign Het
Npdc1 T A 2: 25,408,980 Y237* probably null Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr722 A G 14: 49,895,007 L265P probably benign Het
Oprm1 A G 10: 6,832,520 M388V probably benign Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Pwp1 A G 10: 85,882,034 T279A possibly damaging Het
Rbm34 T C 8: 126,949,287 K426R probably benign Het
Rgs14 T G 13: 55,369,913 L8V probably damaging Het
Ripor2 A G 13: 24,696,538 H407R probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc39a12 T C 2: 14,452,117 F603L probably damaging Het
Smg5 T C 3: 88,349,158 S244P probably benign Het
St3gal3 T C 4: 117,940,440 I252V probably benign Het
Tarsl2 T A 7: 65,678,128 D528E probably damaging Het
Try10 A G 6: 41,356,674 T118A probably benign Het
Tshr C T 12: 91,537,494 S402L probably benign Het
Other mutations in Rabep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Rabep2 APN 7 126440394 missense possibly damaging 0.56
R0799:Rabep2 UTSW 7 126438724 missense probably damaging 1.00
R1219:Rabep2 UTSW 7 126429627 missense probably damaging 1.00
R1731:Rabep2 UTSW 7 126444272 missense probably damaging 1.00
R1735:Rabep2 UTSW 7 126444540 missense probably damaging 1.00
R1789:Rabep2 UTSW 7 126438799 missense possibly damaging 0.76
R1951:Rabep2 UTSW 7 126438564 missense possibly damaging 0.67
R2113:Rabep2 UTSW 7 126445288 splice site probably null
R4357:Rabep2 UTSW 7 126448225 missense probably damaging 1.00
R4915:Rabep2 UTSW 7 126444922 missense probably damaging 1.00
R5176:Rabep2 UTSW 7 126434293 intron probably benign
R5512:Rabep2 UTSW 7 126438799 missense possibly damaging 0.76
R6729:Rabep2 UTSW 7 126440197 missense probably benign 0.00
R7055:Rabep2 UTSW 7 126445313 missense possibly damaging 0.94
R7288:Rabep2 UTSW 7 126444205 missense probably damaging 1.00
R7419:Rabep2 UTSW 7 126444170 missense probably benign 0.07
R7426:Rabep2 UTSW 7 126438719 missense probably damaging 1.00
R7477:Rabep2 UTSW 7 126444818 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GACCCCATGTAAACACAGGTTG -3'
(R):5'- TGGGACCCTTTTCCAGGTATC -3'

Sequencing Primer
(F):5'- CCCCATGTAAACACAGGTTGATTCTG -3'
(R):5'- AGGTATCATCCCTGAGGGCAG -3'
Posted On2015-04-29