Incidental Mutation 'R4008:Clvs2'
ID311572
Institutional Source Beutler Lab
Gene Symbol Clvs2
Ensembl Gene ENSMUSG00000019785
Gene Nameclavesin 2
SynonymsRlbp1l2, A330019N05Rik
MMRRC Submission 040946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4008 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33512286-33624769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33543462 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 199 (H199Y)
Ref Sequence ENSEMBL: ENSMUSP00000019920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019920]
Predicted Effect probably damaging
Transcript: ENSMUST00000019920
AA Change: H199Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019920
Gene: ENSMUSG00000019785
AA Change: H199Y

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
SEC14 96 254 1.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159533
Meta Mutation Damage Score 0.5850 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the SEC14/CRAL-TRIO family of proteins. A similar protein in rat is thought to function in the endosomal pathway between early endosomes and mature lysosomes. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Batf2 G A 19: 6,171,348 E63K probably damaging Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
H2-K1 G A 17: 33,999,551 probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Larp7 T C 3: 127,540,870 D490G probably benign Het
Map9 T C 3: 82,359,083 Y12H probably damaging Het
Mn1 G T 5: 111,420,169 E668D probably benign Het
Mrps18c T C 5: 100,803,116 probably benign Het
Npdc1 T A 2: 25,408,980 Y237* probably null Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr722 A G 14: 49,895,007 L265P probably benign Het
Oprm1 A G 10: 6,832,520 M388V probably benign Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Pwp1 A G 10: 85,882,034 T279A possibly damaging Het
Rabep2 C A 7: 126,445,374 D547E probably damaging Het
Rbm34 T C 8: 126,949,287 K426R probably benign Het
Rgs14 T G 13: 55,369,913 L8V probably damaging Het
Ripor2 A G 13: 24,696,538 H407R probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc39a12 T C 2: 14,452,117 F603L probably damaging Het
Smg5 T C 3: 88,349,158 S244P probably benign Het
St3gal3 T C 4: 117,940,440 I252V probably benign Het
Tarsl2 T A 7: 65,678,128 D528E probably damaging Het
Try10 A G 6: 41,356,674 T118A probably benign Het
Tshr C T 12: 91,537,494 S402L probably benign Het
Other mutations in Clvs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Clvs2 APN 10 33528463 missense probably benign 0.03
IGL02304:Clvs2 APN 10 33528447 missense probably benign 0.02
IGL02967:Clvs2 APN 10 33595788 missense probably damaging 0.98
R0085:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R0346:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R1228:Clvs2 UTSW 10 33622604 missense probably benign 0.05
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R2176:Clvs2 UTSW 10 33595815 missense probably damaging 1.00
R2280:Clvs2 UTSW 10 33528500 missense probably damaging 1.00
R3413:Clvs2 UTSW 10 33622971 start gained probably benign
R4855:Clvs2 UTSW 10 33622646 missense probably damaging 1.00
R5814:Clvs2 UTSW 10 33528507 missense probably benign 0.01
R6265:Clvs2 UTSW 10 33528515 missense possibly damaging 0.93
R6730:Clvs2 UTSW 10 33528521 missense probably damaging 1.00
R7558:Clvs2 UTSW 10 33543464 missense probably damaging 1.00
R7955:Clvs2 UTSW 10 33595812 missense possibly damaging 0.90
R8337:Clvs2 UTSW 10 33528488 missense possibly damaging 0.95
R8423:Clvs2 UTSW 10 33622859 missense possibly damaging 0.58
RF003:Clvs2 UTSW 10 33622925 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAACAAGCACTCGTTTGTCAG -3'
(R):5'- ATGTCTGATGAGAGTCTTACGG -3'

Sequencing Primer
(F):5'- ACACTCACATTTCATTATTTGGTGAG -3'
(R):5'- TACGGTGGCAAGACTTGGTCC -3'
Posted On2015-04-29