Incidental Mutation 'R4009:Kcnh1'
ID311586
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
MMRRC Submission 040846-MU
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4009 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 192277140 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 334 (I334N)
Ref Sequence ENSEMBL: ENSMUSP00000077563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
PDB Structure
Cyclic nucleotide binding-homology domain from mouse EAG1 potassium channel [X-RAY DIFFRACTION]
Crystal structure of PAS domain from the mouse EAG1 potassium channel [X-RAY DIFFRACTION]
Structure of the eag domain-CNBHD complex of the mouse EAG1 channel [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000078470
AA Change: I334N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: I334N

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110844
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,090,107 L35Q probably damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Apc2 T A 10: 80,313,592 D1464E probably benign Het
Atp8a2 A G 14: 60,027,985 S301P possibly damaging Het
Cntln A G 4: 85,063,215 T877A probably benign Het
Cntn6 T C 6: 104,833,822 I537T probably damaging Het
Cyp2d12 T G 15: 82,556,292 L94R probably damaging Het
Dnah7a A G 1: 53,525,005 L1965P probably damaging Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Gna13 A G 11: 109,396,017 D222G probably damaging Het
Grm7 T A 6: 111,495,722 Y841N probably damaging Het
Kat2b G A 17: 53,644,741 probably null Het
Kcng4 A G 8: 119,626,085 V362A probably damaging Het
Mapkbp1 T C 2: 120,023,605 S1222P probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr742 T C 14: 50,515,962 S253P possibly damaging Het
Pik3cb A G 9: 99,040,929 Y1017H probably damaging Het
Plpp5 A G 8: 25,720,311 E36G probably damaging Het
Pnmal1 A T 7: 16,961,376 K385N probably damaging Het
Ptprd T G 4: 75,956,397 M1272L possibly damaging Het
Rad51ap2 A G 12: 11,457,051 I325V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint4 T C 4: 112,120,109 V232A possibly damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Tcerg1 CAATTGAAAA CAA 18: 42,564,136 probably null Het
Tenm3 C A 8: 48,349,223 K162N probably damaging Het
Vmn2r44 T A 7: 8,377,988 Q302L possibly damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 intron probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R7945:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCATCGTGGATGTCATC -3'
(R):5'- GATACCCATGGTGCATGCTC -3'

Sequencing Primer
(F):5'- GAATTTTCACACCACCTTTGTCGGG -3'
(R):5'- ATGGTGCATGCTCCCTCTG -3'
Posted On2015-04-29