Incidental Mutation 'R4009:Fxr1'
ID311592
Institutional Source Beutler Lab
Gene Symbol Fxr1
Ensembl Gene ENSMUSG00000027680
Gene Namefragile X mental retardation gene 1, autosomal homolog
Synonyms9530073J07Rik, Fxr1p, Fxr1h, 1110050J02Rik
MMRRC Submission 040846-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4009 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location34019943-34070322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34065022 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 580 (R580L)
Ref Sequence ENSEMBL: ENSMUSP00000001620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001620] [ENSMUST00000011029] [ENSMUST00000167354] [ENSMUST00000197694] [ENSMUST00000198051] [ENSMUST00000200086] [ENSMUST00000200392]
Predicted Effect probably benign
Transcript: ENSMUST00000001620
AA Change: R580L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001620
Gene: ENSMUSG00000027680
AA Change: R580L

DomainStartEndE-ValueType
Pfam:Agenet 2 55 4.4e-7 PFAM
Pfam:Agenet 62 120 7.1e-10 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
low complexity region 404 421 N/A INTRINSIC
Pfam:FXR_C1 489 564 1.9e-41 PFAM
low complexity region 572 582 N/A INTRINSIC
Pfam:FXR_C3 610 676 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000011029
SMART Domains Protein: ENSMUSP00000011029
Gene: ENSMUSG00000027679

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
DnaJ 61 101 1.31e-1 SMART
low complexity region 106 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167354
SMART Domains Protein: ENSMUSP00000130216
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197694
SMART Domains Protein: ENSMUSP00000142441
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.9e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 5e-9 PFAM
Pfam:FXR1P_C 379 486 1.8e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198051
SMART Domains Protein: ENSMUSP00000142847
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
Pfam:Agenet 59 120 1.2e-11 PFAM
KH 217 284 2.2e-6 SMART
KH 286 356 7.5e-5 SMART
Pfam:FXR1P_C 361 515 1.6e-64 PFAM
low complexity region 531 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200086
SMART Domains Protein: ENSMUSP00000143562
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
PDB:3O8V|A 2 40 1e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200392
SMART Domains Protein: ENSMUSP00000143392
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA binding protein that interacts with the functionally-similar proteins FMR1 and FXR2. These proteins shuttle between the nucleus and cytoplasm and associate with polyribosomes, predominantly with the 60S ribosomal subunit. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired muscle development. Mice homozygous for a hypomorphic allele display a reduced life span with impaired muscle development, growth retardation, and reduced grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,090,107 L35Q probably damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Apc2 T A 10: 80,313,592 D1464E probably benign Het
Atp8a2 A G 14: 60,027,985 S301P possibly damaging Het
Cntln A G 4: 85,063,215 T877A probably benign Het
Cntn6 T C 6: 104,833,822 I537T probably damaging Het
Cyp2d12 T G 15: 82,556,292 L94R probably damaging Het
Dnah7a A G 1: 53,525,005 L1965P probably damaging Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Gna13 A G 11: 109,396,017 D222G probably damaging Het
Grm7 T A 6: 111,495,722 Y841N probably damaging Het
Kat2b G A 17: 53,644,741 probably null Het
Kcng4 A G 8: 119,626,085 V362A probably damaging Het
Kcnh1 T A 1: 192,277,140 I334N probably benign Het
Mapkbp1 T C 2: 120,023,605 S1222P probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr742 T C 14: 50,515,962 S253P possibly damaging Het
Pik3cb A G 9: 99,040,929 Y1017H probably damaging Het
Plpp5 A G 8: 25,720,311 E36G probably damaging Het
Pnmal1 A T 7: 16,961,376 K385N probably damaging Het
Ptprd T G 4: 75,956,397 M1272L possibly damaging Het
Rad51ap2 A G 12: 11,457,051 I325V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint4 T C 4: 112,120,109 V232A possibly damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Tcerg1 CAATTGAAAA CAA 18: 42,564,136 probably null Het
Tenm3 C A 8: 48,349,223 K162N probably damaging Het
Vmn2r44 T A 7: 8,377,988 Q302L possibly damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Fxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Fxr1 APN 3 34047627 splice site probably benign
IGL01598:Fxr1 APN 3 34064232 missense possibly damaging 0.61
Outer_limits UTSW 3 34039543 missense probably benign 0.30
pueblo UTSW 3 34064232 missense possibly damaging 0.61
R4877_Fxr1_968 UTSW 3 34047698 missense probably damaging 0.99
R1294:Fxr1 UTSW 3 34047052 missense probably benign 0.00
R2134:Fxr1 UTSW 3 34058047 missense probably damaging 1.00
R2405:Fxr1 UTSW 3 34061854 missense probably damaging 1.00
R3023:Fxr1 UTSW 3 34064224 missense probably damaging 1.00
R3055:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R3056:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R4010:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4706:Fxr1 UTSW 3 34064129 missense probably damaging 0.99
R4721:Fxr1 UTSW 3 34064232 missense possibly damaging 0.61
R4877:Fxr1 UTSW 3 34047698 missense probably damaging 0.99
R5583:Fxr1 UTSW 3 34068976 missense probably benign 0.18
R6280:Fxr1 UTSW 3 34046252 intron probably benign
R6801:Fxr1 UTSW 3 34054303 missense possibly damaging 0.65
R7203:Fxr1 UTSW 3 34046540 missense possibly damaging 0.76
R7422:Fxr1 UTSW 3 34049220 missense probably damaging 1.00
R7523:Fxr1 UTSW 3 34039543 missense probably benign 0.30
R7785:Fxr1 UTSW 3 34046254 missense
R8195:Fxr1 UTSW 3 34047729 missense probably damaging 1.00
R8250:Fxr1 UTSW 3 34047029 nonsense probably null
R8809:Fxr1 UTSW 3 34054281 missense possibly damaging 0.75
X0067:Fxr1 UTSW 3 34046044 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGAGGGCAGTGCTTTATGC -3'
(R):5'- GGAAGAATGCATTTTCTTGAGCAG -3'

Sequencing Primer
(F):5'- CTTTCCCTTCCTTAAATAAGGAA -3'
(R):5'- GCATTTTCTTGAGCAGCATTATTAG -3'
Posted On2015-04-29