Mutagenetix > Incidental Mutation

Incidental Mutation 'R4009:Cntln'

311595

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

040846-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R4009 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85063215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 877 (T877A)

Ref Sequence

ENSEMBL: ENSMUSP00000044138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably benign
Transcript: ENSMUST00000047023
AA Change: T877A

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T877A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169371
AA Change: T876A

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T876A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,090,107	L35Q	probably damaging	Het
Acss2	T	A	2: 155,557,628	L529Q	probably damaging	Het
Apc2	T	A	10: 80,313,592	D1464E	probably benign	Het
Atp8a2	A	G	14: 60,027,985	S301P	possibly damaging	Het
Cntn6	T	C	6: 104,833,822	I537T	probably damaging	Het
Cyp2d12	T	G	15: 82,556,292	L94R	probably damaging	Het
Dnah7a	A	G	1: 53,525,005	L1965P	probably damaging	Het
Dock10	T	C	1: 80,532,431	N1560S	probably damaging	Het
F830045P16Rik	A	T	2: 129,463,547	N302K	probably damaging	Het
Fxr1	G	T	3: 34,065,022	R580L	probably benign	Het
Gm5592	G	T	7: 41,289,510	V739L	probably benign	Het
Gna13	A	G	11: 109,396,017	D222G	probably damaging	Het
Grm7	T	A	6: 111,495,722	Y841N	probably damaging	Het
Kat2b	G	A	17: 53,644,741		probably null	Het
Kcng4	A	G	8: 119,626,085	V362A	probably damaging	Het
Kcnh1	T	A	1: 192,277,140	I334N	probably benign	Het
Mapkbp1	T	C	2: 120,023,605	S1222P	probably benign	Het
Olfr1122	A	T	2: 87,388,580	I292F	possibly damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr512	A	T	7: 108,714,159	I269L	probably benign	Het
Olfr742	T	C	14: 50,515,962	S253P	possibly damaging	Het
Pik3cb	A	G	9: 99,040,929	Y1017H	probably damaging	Het
Plpp5	A	G	8: 25,720,311	E36G	probably damaging	Het
Pnmal1	A	T	7: 16,961,376	K385N	probably damaging	Het
Ptprd	T	G	4: 75,956,397	M1272L	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,051	I325V	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skint4	T	C	4: 112,120,109	V232A	possibly damaging	Het
Slc30a5	G	A	13: 100,809,233	A537V	probably damaging	Het
Tcerg1	CAATTGAAAA	CAA	18: 42,564,136		probably null	Het
Tenm3	C	A	8: 48,349,223	K162N	probably damaging	Het
Vmn2r44	T	A	7: 8,377,988	Q302L	possibly damaging	Het
Zfp618	G	A	4: 63,133,564	A861T	probably benign	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGCTAGGGATCAAGTTTCC -3'
(R):5'- GGTTAAGAACGTACTGTGGAGC -3'

Sequencing Primer
(F):5'- CTAGGGATCAAGTTTCCTGATGAAG -3'
(R):5'- GCTAAGAAAAGCTAGCATACCTGCG -3'

Posted On

2015-04-29