Incidental Mutation 'R4009:Pik3cb'
ID311608
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission 040846-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4009 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99040929 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1017 (Y1017H)
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035037
AA Change: Y1017H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: Y1017H

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,090,107 L35Q probably damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Apc2 T A 10: 80,313,592 D1464E probably benign Het
Atp8a2 A G 14: 60,027,985 S301P possibly damaging Het
Cntln A G 4: 85,063,215 T877A probably benign Het
Cntn6 T C 6: 104,833,822 I537T probably damaging Het
Cyp2d12 T G 15: 82,556,292 L94R probably damaging Het
Dnah7a A G 1: 53,525,005 L1965P probably damaging Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Gna13 A G 11: 109,396,017 D222G probably damaging Het
Grm7 T A 6: 111,495,722 Y841N probably damaging Het
Kat2b G A 17: 53,644,741 probably null Het
Kcng4 A G 8: 119,626,085 V362A probably damaging Het
Kcnh1 T A 1: 192,277,140 I334N probably benign Het
Mapkbp1 T C 2: 120,023,605 S1222P probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr742 T C 14: 50,515,962 S253P possibly damaging Het
Plpp5 A G 8: 25,720,311 E36G probably damaging Het
Pnmal1 A T 7: 16,961,376 K385N probably damaging Het
Ptprd T G 4: 75,956,397 M1272L possibly damaging Het
Rad51ap2 A G 12: 11,457,051 I325V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint4 T C 4: 112,120,109 V232A possibly damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Tcerg1 CAATTGAAAA CAA 18: 42,564,136 probably null Het
Tenm3 C A 8: 48,349,223 K162N probably damaging Het
Vmn2r44 T A 7: 8,377,988 Q302L possibly damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2513:Pik3cb UTSW 9 99061842 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4249:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 99094598 missense probably benign 0.01
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6781:Pik3cb UTSW 9 99040992 missense possibly damaging 0.52
R6869:Pik3cb UTSW 9 99060259 missense probably benign 0.08
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
R7446:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
R7679:Pik3cb UTSW 9 99088607 missense probably benign 0.05
R7831:Pik3cb UTSW 9 99088613 missense probably benign
R8300:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
R8837:Pik3cb UTSW 9 99054064 missense possibly damaging 0.65
R8911:Pik3cb UTSW 9 99064148 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATCAGATCTTGAGCAGGGAGTTG -3'
(R):5'- ATGCCCTCGCTCTAAAGGTG -3'

Sequencing Primer
(F):5'- AACTCAGAGCTTCAGTCTTGGCAG -3'
(R):5'- AAGGTGTCTTGTTTTCCTTTGCAAAC -3'
Posted On2015-04-29