Incidental Mutation 'R4009:Rad51ap2'
ID311614
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
MMRRC Submission 040846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4009 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11457051 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 325 (I325V)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: I325V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: I325V

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,090,107 L35Q probably damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Apc2 T A 10: 80,313,592 D1464E probably benign Het
Atp8a2 A G 14: 60,027,985 S301P possibly damaging Het
Cntln A G 4: 85,063,215 T877A probably benign Het
Cntn6 T C 6: 104,833,822 I537T probably damaging Het
Cyp2d12 T G 15: 82,556,292 L94R probably damaging Het
Dnah7a A G 1: 53,525,005 L1965P probably damaging Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Gna13 A G 11: 109,396,017 D222G probably damaging Het
Grm7 T A 6: 111,495,722 Y841N probably damaging Het
Kat2b G A 17: 53,644,741 probably null Het
Kcng4 A G 8: 119,626,085 V362A probably damaging Het
Kcnh1 T A 1: 192,277,140 I334N probably benign Het
Mapkbp1 T C 2: 120,023,605 S1222P probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr742 T C 14: 50,515,962 S253P possibly damaging Het
Pik3cb A G 9: 99,040,929 Y1017H probably damaging Het
Plpp5 A G 8: 25,720,311 E36G probably damaging Het
Pnmal1 A T 7: 16,961,376 K385N probably damaging Het
Ptprd T G 4: 75,956,397 M1272L possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint4 T C 4: 112,120,109 V232A possibly damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Tcerg1 CAATTGAAAA CAA 18: 42,564,136 probably null Het
Tenm3 C A 8: 48,349,223 K162N probably damaging Het
Vmn2r44 T A 7: 8,377,988 Q302L possibly damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11458817 critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11457849 missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11459367 nonsense probably null
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11457533 small deletion probably benign
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11457559 missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7916:Rad51ap2 UTSW 12 11456655 missense probably benign
R7922:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R8040:Rad51ap2 UTSW 12 11458791 missense probably benign 0.03
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAAGGGATTTAAATAGCAACATGTCC -3'
(R):5'- CAAAATAGATCTGTCACAGTCCAAG -3'

Sequencing Primer
(F):5'- GCAACATGTCCTTTGTCTATTTAAAG -3'
(R):5'- GATCTGTCACAGTCCAAGTTTTG -3'
Posted On2015-04-29