Incidental Mutation 'R4009:Kat2b'
ID311623
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 040846-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4009 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 53644741 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000166525]
Predicted Effect probably null
Transcript: ENSMUST00000000724
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166525
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,090,107 L35Q probably damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Apc2 T A 10: 80,313,592 D1464E probably benign Het
Atp8a2 A G 14: 60,027,985 S301P possibly damaging Het
Cntln A G 4: 85,063,215 T877A probably benign Het
Cntn6 T C 6: 104,833,822 I537T probably damaging Het
Cyp2d12 T G 15: 82,556,292 L94R probably damaging Het
Dnah7a A G 1: 53,525,005 L1965P probably damaging Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Gna13 A G 11: 109,396,017 D222G probably damaging Het
Grm7 T A 6: 111,495,722 Y841N probably damaging Het
Kcng4 A G 8: 119,626,085 V362A probably damaging Het
Kcnh1 T A 1: 192,277,140 I334N probably benign Het
Mapkbp1 T C 2: 120,023,605 S1222P probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr742 T C 14: 50,515,962 S253P possibly damaging Het
Pik3cb A G 9: 99,040,929 Y1017H probably damaging Het
Plpp5 A G 8: 25,720,311 E36G probably damaging Het
Pnmal1 A T 7: 16,961,376 K385N probably damaging Het
Ptprd T G 4: 75,956,397 M1272L possibly damaging Het
Rad51ap2 A G 12: 11,457,051 I325V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint4 T C 4: 112,120,109 V232A possibly damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Tcerg1 CAATTGAAAA CAA 18: 42,564,136 probably null Het
Tenm3 C A 8: 48,349,223 K162N probably damaging Het
Vmn2r44 T A 7: 8,377,988 Q302L possibly damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
R8250:Kat2b UTSW 17 53663536 missense probably damaging 1.00
R8277:Kat2b UTSW 17 53641253 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGTCATAGGATGGCTTTATG -3'
(R):5'- TGGCTTGTTTGTTACACAGC -3'

Sequencing Primer
(F):5'- ATGGTCTCACATGTCCTTGAG -3'
(R):5'- GCTTGTTTGTTACACAGCAGTACAC -3'
Posted On2015-04-29