Incidental Mutation 'R4010:Usp39'
ID311637
Institutional Source Beutler Lab
Gene Symbol Usp39
Ensembl Gene ENSMUSG00000056305
Gene Nameubiquitin specific peptidase 39
SynonymsSAD1, CGI-21, D6Wsu157e
MMRRC Submission 040947-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4010 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72318678-72345184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72336485 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 241 (A241S)
Ref Sequence ENSEMBL: ENSMUSP00000064515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345]
Predicted Effect probably benign
Transcript: ENSMUST00000070345
AA Change: A241S

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305
AA Change: A241S

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154799
Predicted Effect probably benign
Transcript: ENSMUST00000206262
Meta Mutation Damage Score 0.2319 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,277 S298P probably damaging Het
Abca13 G A 11: 9,622,013 probably benign Het
Abcc2 A G 19: 43,829,864 N1263S possibly damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adamts12 A G 15: 11,286,083 T793A possibly damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Ddx60 A T 8: 61,954,535 D360V possibly damaging Het
Ddx60 A T 8: 61,956,144 M405L probably benign Het
Frmd6 A G 12: 70,899,553 N585S probably benign Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Ggt7 G A 2: 155,500,732 T358M probably benign Het
Gm2000 T C 1: 156,366,154 V26A probably benign Het
Gm5435 G A 12: 82,496,315 noncoding transcript Het
Gm5592 C T 7: 41,286,628 H185Y probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Itgae T A 11: 73,111,339 C90S probably benign Het
Kif1a G A 1: 93,022,409 S1424F probably benign Het
Map2k2 T C 10: 81,108,935 S94P probably damaging Het
Marveld2 C A 13: 100,611,428 probably null Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Pdcl T C 2: 37,352,111 Y209C probably damaging Het
Pde6c A G 19: 38,169,436 E636G probably damaging Het
Pggt1b A G 18: 46,248,936 Y260H possibly damaging Het
Pkhd1l1 T A 15: 44,529,100 S1610R possibly damaging Het
Rel C T 11: 23,761,138 V10I probably benign Het
Rpa2 T A 4: 132,770,649 probably null Het
Rpain T G 11: 70,973,007 probably benign Het
Ryr1 T C 7: 29,095,124 T1237A probably benign Het
Safb T C 17: 56,603,765 probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Setd2 A G 9: 110,599,195 Q2320R probably null Het
Sh2d4a C T 8: 68,335,147 R302C probably damaging Het
Slc19a2 T G 1: 164,260,882 S300A probably damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Strip2 A G 6: 29,955,585 I717V possibly damaging Het
Supt16 A C 14: 52,164,441 F924C probably damaging Het
Tekt4 T G 17: 25,476,486 M431R probably damaging Het
Trim23 A G 13: 104,181,018 probably benign Het
Tspear T C 10: 77,836,476 probably benign Het
Vmn1r185 T A 7: 26,612,025 L18F possibly damaging Het
Zfp213 T C 17: 23,558,090 H326R possibly damaging Het
Zfp354c T A 11: 50,814,944 I435F probably damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Usp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Usp39 APN 6 72328624 missense probably damaging 0.99
IGL01065:Usp39 APN 6 72339975 missense probably damaging 1.00
IGL01669:Usp39 APN 6 72338493 missense probably damaging 0.99
IGL03089:Usp39 APN 6 72328639 missense probably damaging 1.00
IGL03397:Usp39 APN 6 72336313 missense possibly damaging 0.53
R0561:Usp39 UTSW 6 72336385 missense probably damaging 1.00
R3236:Usp39 UTSW 6 72338389 splice site probably benign
R3552:Usp39 UTSW 6 72337832 missense possibly damaging 0.63
R4854:Usp39 UTSW 6 72325682 missense probably benign 0.29
R5502:Usp39 UTSW 6 72328687 missense probably benign
R6868:Usp39 UTSW 6 72337751 missense possibly damaging 0.93
R6887:Usp39 UTSW 6 72333157 missense probably damaging 1.00
R7313:Usp39 UTSW 6 72336430 missense probably benign 0.00
R7429:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7430:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7431:Usp39 UTSW 6 72336268 missense possibly damaging 0.66
R7544:Usp39 UTSW 6 72342908 missense probably damaging 1.00
R7548:Usp39 UTSW 6 72345013 missense possibly damaging 0.93
R7741:Usp39 UTSW 6 72338538 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TCATGAGGAGAGACATGCGC -3'
(R):5'- GCATCATTTTCAGAGGGTCAGTTTC -3'

Sequencing Primer
(F):5'- AGAGACATGCGCCTTGAAGTTTC -3'
(R):5'- CAGGCTGGCTTTGAACTCAGAAATC -3'
Posted On2015-04-29