Incidental Mutation 'R4010:Vmn1r185'
ID311638
Institutional Source Beutler Lab
Gene Symbol Vmn1r185
Ensembl Gene ENSMUSG00000091924
Gene Namevomeronasal 1 receptor 185
SynonymsV1re12
MMRRC Submission 040947-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4010 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26607636-26618464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26612025 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 18 (L18F)
Ref Sequence ENSEMBL: ENSMUSP00000154688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171039] [ENSMUST00000226694] [ENSMUST00000227264] [ENSMUST00000227411] [ENSMUST00000227461] [ENSMUST00000227479] [ENSMUST00000227695] [ENSMUST00000228004] [ENSMUST00000228133] [ENSMUST00000228367] [ENSMUST00000228467] [ENSMUST00000228633] [ENSMUST00000228676]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171039
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128295
Gene: ENSMUSG00000091924
AA Change: L18F

DomainStartEndE-ValueType
Pfam:TAS2R 7 307 4.1e-8 PFAM
Pfam:V1R 38 297 1.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226694
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227264
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227411
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227461
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227479
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227695
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228004
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228133
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228367
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228467
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228633
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228676
AA Change: L18F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,277 S298P probably damaging Het
Abca13 G A 11: 9,622,013 probably benign Het
Abcc2 A G 19: 43,829,864 N1263S possibly damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adamts12 A G 15: 11,286,083 T793A possibly damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Ddx60 A T 8: 61,954,535 D360V possibly damaging Het
Ddx60 A T 8: 61,956,144 M405L probably benign Het
Frmd6 A G 12: 70,899,553 N585S probably benign Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Ggt7 G A 2: 155,500,732 T358M probably benign Het
Gm2000 T C 1: 156,366,154 V26A probably benign Het
Gm5435 G A 12: 82,496,315 noncoding transcript Het
Gm5592 C T 7: 41,286,628 H185Y probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Itgae T A 11: 73,111,339 C90S probably benign Het
Kif1a G A 1: 93,022,409 S1424F probably benign Het
Map2k2 T C 10: 81,108,935 S94P probably damaging Het
Marveld2 C A 13: 100,611,428 probably null Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Pdcl T C 2: 37,352,111 Y209C probably damaging Het
Pde6c A G 19: 38,169,436 E636G probably damaging Het
Pggt1b A G 18: 46,248,936 Y260H possibly damaging Het
Pkhd1l1 T A 15: 44,529,100 S1610R possibly damaging Het
Rel C T 11: 23,761,138 V10I probably benign Het
Rpa2 T A 4: 132,770,649 probably null Het
Rpain T G 11: 70,973,007 probably benign Het
Ryr1 T C 7: 29,095,124 T1237A probably benign Het
Safb T C 17: 56,603,765 probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Setd2 A G 9: 110,599,195 Q2320R probably null Het
Sh2d4a C T 8: 68,335,147 R302C probably damaging Het
Slc19a2 T G 1: 164,260,882 S300A probably damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Strip2 A G 6: 29,955,585 I717V possibly damaging Het
Supt16 A C 14: 52,164,441 F924C probably damaging Het
Tekt4 T G 17: 25,476,486 M431R probably damaging Het
Trim23 A G 13: 104,181,018 probably benign Het
Tspear T C 10: 77,836,476 probably benign Het
Usp39 C A 6: 72,336,485 A241S probably benign Het
Zfp213 T C 17: 23,558,090 H326R possibly damaging Het
Zfp354c T A 11: 50,814,944 I435F probably damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Vmn1r185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn1r185 APN 7 26611190 missense probably benign 0.00
IGL00938:Vmn1r185 APN 7 26611691 missense probably benign
IGL01413:Vmn1r185 APN 7 26611621 missense probably damaging 0.99
R0207:Vmn1r185 UTSW 7 26611589 missense possibly damaging 0.80
R1497:Vmn1r185 UTSW 7 26611794 missense probably benign 0.01
R1505:Vmn1r185 UTSW 7 26611478 missense probably damaging 0.99
R1966:Vmn1r185 UTSW 7 26611531 missense probably benign 0.31
R2022:Vmn1r185 UTSW 7 26611510 missense possibly damaging 0.86
R4093:Vmn1r185 UTSW 7 26611783 missense probably damaging 1.00
R4095:Vmn1r185 UTSW 7 26611783 missense probably damaging 1.00
R4961:Vmn1r185 UTSW 7 26611291 missense probably benign 0.43
R5049:Vmn1r185 UTSW 7 26611495 missense possibly damaging 0.95
R6297:Vmn1r185 UTSW 7 26611621 missense probably benign 0.10
R6903:Vmn1r185 UTSW 7 26611735 missense probably damaging 1.00
R7046:Vmn1r185 UTSW 7 26611226 missense probably damaging 1.00
R7429:Vmn1r185 UTSW 7 26611178 missense probably benign 0.13
R8032:Vmn1r185 UTSW 7 26611133 missense probably benign 0.15
X0063:Vmn1r185 UTSW 7 26611903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGCTATTATGTGGGGCAC -3'
(R):5'- GTCAAAATTTTGGGGATGAGGC -3'

Sequencing Primer
(F):5'- ATGTGGGGCACTCCTGAAG -3'
(R):5'- ATCCTGTATTCTTGAAGTTCCAGG -3'
Posted On2015-04-29