Incidental Mutation 'R4010:Tspear'
ID311647
Institutional Source Beutler Lab
Gene Symbol Tspear
Ensembl Gene ENSMUSG00000069581
Gene Namethrombospondin type laminin G domain and EAR repeats
SynonymsC330046G03Rik, ORF65
MMRRC Submission 040947-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4010 (G1)
Quality Score94
Status Validated
Chromosome10
Chromosomal Location77686569-77887021 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 77836476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366] [ENSMUST00000218843] [ENSMUST00000220393]
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177672
AA Change: S170P
SMART Domains Protein: ENSMUSP00000137532
Gene: ENSMUSG00000096131
AA Change: S170P

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 5 60 2.5e-8 PFAM
Pfam:Keratin_B2_2 47 88 8.8e-11 PFAM
Pfam:Keratin_B2_2 83 132 1.1e-8 PFAM
internal_repeat_1 189 206 3.07e-7 PROSPERO
internal_repeat_1 204 221 3.07e-7 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000218843
AA Change: S160P
Predicted Effect unknown
Transcript: ENSMUST00000220393
AA Change: S170P
Meta Mutation Damage Score 0.1502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,277 S298P probably damaging Het
Abca13 G A 11: 9,622,013 probably benign Het
Abcc2 A G 19: 43,829,864 N1263S possibly damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adamts12 A G 15: 11,286,083 T793A possibly damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Ddx60 A T 8: 61,954,535 D360V possibly damaging Het
Ddx60 A T 8: 61,956,144 M405L probably benign Het
Frmd6 A G 12: 70,899,553 N585S probably benign Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Ggt7 G A 2: 155,500,732 T358M probably benign Het
Gm2000 T C 1: 156,366,154 V26A probably benign Het
Gm5435 G A 12: 82,496,315 noncoding transcript Het
Gm5592 C T 7: 41,286,628 H185Y probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Itgae T A 11: 73,111,339 C90S probably benign Het
Kif1a G A 1: 93,022,409 S1424F probably benign Het
Map2k2 T C 10: 81,108,935 S94P probably damaging Het
Marveld2 C A 13: 100,611,428 probably null Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Pdcl T C 2: 37,352,111 Y209C probably damaging Het
Pde6c A G 19: 38,169,436 E636G probably damaging Het
Pggt1b A G 18: 46,248,936 Y260H possibly damaging Het
Pkhd1l1 T A 15: 44,529,100 S1610R possibly damaging Het
Rel C T 11: 23,761,138 V10I probably benign Het
Rpa2 T A 4: 132,770,649 probably null Het
Rpain T G 11: 70,973,007 probably benign Het
Ryr1 T C 7: 29,095,124 T1237A probably benign Het
Safb T C 17: 56,603,765 probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Setd2 A G 9: 110,599,195 Q2320R probably null Het
Sh2d4a C T 8: 68,335,147 R302C probably damaging Het
Slc19a2 T G 1: 164,260,882 S300A probably damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Strip2 A G 6: 29,955,585 I717V possibly damaging Het
Supt16 A C 14: 52,164,441 F924C probably damaging Het
Tekt4 T G 17: 25,476,486 M431R probably damaging Het
Trim23 A G 13: 104,181,018 probably benign Het
Usp39 C A 6: 72,336,485 A241S probably benign Het
Vmn1r185 T A 7: 26,612,025 L18F possibly damaging Het
Zfp213 T C 17: 23,558,090 H326R possibly damaging Het
Zfp354c T A 11: 50,814,944 I435F probably damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Tspear
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tspear APN 10 77873236 missense probably benign 0.30
IGL01726:Tspear APN 10 77881287 intron probably benign
IGL02244:Tspear APN 10 77852856 unclassified probably benign
IGL02393:Tspear APN 10 77836573 missense probably damaging 1.00
IGL02502:Tspear APN 10 77852958 intron probably benign
IGL02653:Tspear APN 10 77706965 utr 3 prime probably benign
IGL03345:Tspear APN 10 77874882 splice site probably null
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0542:Tspear UTSW 10 77881087 missense probably benign 0.14
R1384:Tspear UTSW 10 77866332 missense probably benign 0.44
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1545:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1625:Tspear UTSW 10 77870499 missense probably benign 0.20
R1635:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1636:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1637:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1744:Tspear UTSW 10 77864884 unclassified probably null
R1749:Tspear UTSW 10 77869673 missense probably benign 0.00
R1768:Tspear UTSW 10 77875116 critical splice donor site probably null
R1774:Tspear UTSW 10 77873185 missense probably benign 0.01
R1791:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1892:Tspear UTSW 10 77870474 missense probably benign 0.00
R2014:Tspear UTSW 10 77875120 splice site probably benign
R2108:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R2248:Tspear UTSW 10 77873269 missense probably damaging 1.00
R3038:Tspear UTSW 10 77886439 nonsense probably null
R4661:Tspear UTSW 10 77866329 missense probably benign 0.24
R4734:Tspear UTSW 10 77864695 missense probably damaging 0.99
R4789:Tspear UTSW 10 77866365 missense possibly damaging 0.63
R4804:Tspear UTSW 10 77776957 unclassified probably null
R4904:Tspear UTSW 10 77869655 missense possibly damaging 0.93
R4937:Tspear UTSW 10 77875043 missense probably damaging 0.98
R4956:Tspear UTSW 10 77864767 missense possibly damaging 0.86
R5590:Tspear UTSW 10 77870365 missense probably benign
R6344:Tspear UTSW 10 77875013 missense possibly damaging 0.95
R6629:Tspear UTSW 10 77870509 missense probably benign 0.08
R7611:Tspear UTSW 10 77881215 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTGCTCTGATGCTCGCAC -3'
(R):5'- GCACCTGGGGAATTCTAAAGC -3'

Sequencing Primer
(F):5'- ATGACTGCCCAGAGAGCTG -3'
(R):5'- CCTGGGGAATTCTAAAGCATGGG -3'
Posted On2015-04-29