Incidental Mutation 'R4010:Marveld2'
ID311658
Institutional Source Beutler Lab
Gene Symbol Marveld2
Ensembl Gene ENSMUSG00000021636
Gene NameMARVEL (membrane-associating) domain containing 2
SynonymsTric-b, Tricellulin, Tric, Mrvldc2, Tric-c, Tric-a
MMRRC Submission 040947-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4010 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100595957-100616971 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 100611428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022137] [ENSMUST00000163163] [ENSMUST00000168772] [ENSMUST00000225754]
Predicted Effect probably null
Transcript: ENSMUST00000022137
SMART Domains Protein: ENSMUSP00000022137
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 4.1e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 2.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163163
SMART Domains Protein: ENSMUSP00000129990
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 25 53 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Pfam:Occludin_ELL 166 268 4.2e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168772
SMART Domains Protein: ENSMUSP00000126438
Gene: ENSMUSG00000021636

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 3.6e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 6.6e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000225754
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein found at the tight junctions between epithelial cells. The encoded protein helps establish epithelial barriers such as those in the organ of Corti, where these barriers are required for normal hearing. Defects in this gene are a cause of deafness autosomal recessive type 49 (DFNB49). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in mutation fisplay syndromic deafness with rapid progressive degeneration of the hair cells, increased body and organ weights and abnormal tricellular tight junctions. However, vestibular function is intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,277 S298P probably damaging Het
Abca13 G A 11: 9,622,013 probably benign Het
Abcc2 A G 19: 43,829,864 N1263S possibly damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adamts12 A G 15: 11,286,083 T793A possibly damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Ddx60 A T 8: 61,956,144 M405L probably benign Het
Ddx60 A T 8: 61,954,535 D360V possibly damaging Het
Frmd6 A G 12: 70,899,553 N585S probably benign Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Ggt7 G A 2: 155,500,732 T358M probably benign Het
Gm2000 T C 1: 156,366,154 V26A probably benign Het
Gm5435 G A 12: 82,496,315 noncoding transcript Het
Gm5592 C T 7: 41,286,628 H185Y probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Itgae T A 11: 73,111,339 C90S probably benign Het
Kif1a G A 1: 93,022,409 S1424F probably benign Het
Map2k2 T C 10: 81,108,935 S94P probably damaging Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Pdcl T C 2: 37,352,111 Y209C probably damaging Het
Pde6c A G 19: 38,169,436 E636G probably damaging Het
Pggt1b A G 18: 46,248,936 Y260H possibly damaging Het
Pkhd1l1 T A 15: 44,529,100 S1610R possibly damaging Het
Rel C T 11: 23,761,138 V10I probably benign Het
Rpa2 T A 4: 132,770,649 probably null Het
Rpain T G 11: 70,973,007 probably benign Het
Ryr1 T C 7: 29,095,124 T1237A probably benign Het
Safb T C 17: 56,603,765 probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Setd2 A G 9: 110,599,195 Q2320R probably null Het
Sh2d4a C T 8: 68,335,147 R302C probably damaging Het
Slc19a2 T G 1: 164,260,882 S300A probably damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Strip2 A G 6: 29,955,585 I717V possibly damaging Het
Supt16 A C 14: 52,164,441 F924C probably damaging Het
Tekt4 T G 17: 25,476,486 M431R probably damaging Het
Trim23 A G 13: 104,181,018 probably benign Het
Tspear T C 10: 77,836,476 probably benign Het
Usp39 C A 6: 72,336,485 A241S probably benign Het
Vmn1r185 T A 7: 26,612,025 L18F possibly damaging Het
Zfp213 T C 17: 23,558,090 H326R possibly damaging Het
Zfp354c T A 11: 50,814,944 I435F probably damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Marveld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Marveld2 APN 13 100600893 missense possibly damaging 0.83
IGL00573:Marveld2 APN 13 100597859 splice site probably benign
R1569:Marveld2 UTSW 13 100600998 missense probably benign 0.32
R1884:Marveld2 UTSW 13 100600621 missense probably benign 0.15
R1958:Marveld2 UTSW 13 100597350 missense probably damaging 1.00
R2249:Marveld2 UTSW 13 100612091 missense probably benign
R2258:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2259:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2260:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2473:Marveld2 UTSW 13 100597321 missense probably damaging 0.98
R3918:Marveld2 UTSW 13 100611893 missense probably benign 0.01
R4089:Marveld2 UTSW 13 100600480 missense probably benign 0.04
R4634:Marveld2 UTSW 13 100611939 missense probably damaging 1.00
R4775:Marveld2 UTSW 13 100616795 unclassified probably benign
R4961:Marveld2 UTSW 13 100611923 missense probably benign 0.12
R5424:Marveld2 UTSW 13 100612187 missense probably benign
R5546:Marveld2 UTSW 13 100600938 missense probably benign 0.14
R5900:Marveld2 UTSW 13 100611668 missense probably damaging 1.00
R5977:Marveld2 UTSW 13 100611689 missense possibly damaging 0.87
R6177:Marveld2 UTSW 13 100597378 missense probably damaging 0.99
R7409:Marveld2 UTSW 13 100611476 missense probably damaging 0.99
R7484:Marveld2 UTSW 13 100611560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCGTCTCTCTGAGATAAC -3'
(R):5'- TGTGAACGATACCAACCGAG -3'

Sequencing Primer
(F):5'- GCGTCTCTCTGAGATAACAAGCAG -3'
(R):5'- ATACCAACCGAGGTGGACTCTG -3'
Posted On2015-04-29