Incidental Mutation 'R4010:Zfp213'
ID311664
Institutional Source Beutler Lab
Gene Symbol Zfp213
Ensembl Gene ENSMUSG00000071256
Gene Namezinc finger protein 213
SynonymsD17Ertd197e
MMRRC Submission 040947-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4010 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location23556769-23564226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23558090 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 326 (H326R)
Ref Sequence ENSEMBL: ENSMUSP00000093266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088673] [ENSMUST00000095606] [ENSMUST00000182769]
Predicted Effect probably benign
Transcript: ENSMUST00000088673
SMART Domains Protein: ENSMUSP00000086048
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 3 162 4.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095606
AA Change: H326R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093266
Gene: ENSMUSG00000071256
AA Change: H326R

DomainStartEndE-ValueType
SCAN 41 145 3.11e-56 SMART
KRAB 213 278 3.21e-4 SMART
ZnF_C2H2 326 348 3.89e-3 SMART
ZnF_C2H2 354 376 9.88e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.95e-3 SMART
ZnF_C2H2 438 460 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180920
Predicted Effect probably benign
Transcript: ENSMUST00000182769
SMART Domains Protein: ENSMUSP00000138283
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 18 175 1.7e-7 PFAM
Meta Mutation Damage Score 0.6501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2H2 zinc finger proteins, such as ZNF213, have bipartite structures in which one domain binds DNA or RNA and the other modulates target gene expression.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T C 5: 87,972,277 S298P probably damaging Het
Abca13 G A 11: 9,622,013 probably benign Het
Abcc2 A G 19: 43,829,864 N1263S possibly damaging Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adamts12 A G 15: 11,286,083 T793A possibly damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Ddx60 A T 8: 61,954,535 D360V possibly damaging Het
Ddx60 A T 8: 61,956,144 M405L probably benign Het
Frmd6 A G 12: 70,899,553 N585S probably benign Het
Fxr1 G T 3: 34,065,022 R580L probably benign Het
Ggt7 G A 2: 155,500,732 T358M probably benign Het
Gm2000 T C 1: 156,366,154 V26A probably benign Het
Gm5435 G A 12: 82,496,315 noncoding transcript Het
Gm5592 C T 7: 41,286,628 H185Y probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Itgae T A 11: 73,111,339 C90S probably benign Het
Kif1a G A 1: 93,022,409 S1424F probably benign Het
Map2k2 T C 10: 81,108,935 S94P probably damaging Het
Marveld2 C A 13: 100,611,428 probably null Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Pdcl T C 2: 37,352,111 Y209C probably damaging Het
Pde6c A G 19: 38,169,436 E636G probably damaging Het
Pggt1b A G 18: 46,248,936 Y260H possibly damaging Het
Pkhd1l1 T A 15: 44,529,100 S1610R possibly damaging Het
Rel C T 11: 23,761,138 V10I probably benign Het
Rpa2 T A 4: 132,770,649 probably null Het
Rpain T G 11: 70,973,007 probably benign Het
Ryr1 T C 7: 29,095,124 T1237A probably benign Het
Safb T C 17: 56,603,765 probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Setd2 A G 9: 110,599,195 Q2320R probably null Het
Sh2d4a C T 8: 68,335,147 R302C probably damaging Het
Slc19a2 T G 1: 164,260,882 S300A probably damaging Het
Slc30a5 G A 13: 100,809,233 A537V probably damaging Het
Strip2 A G 6: 29,955,585 I717V possibly damaging Het
Supt16 A C 14: 52,164,441 F924C probably damaging Het
Tekt4 T G 17: 25,476,486 M431R probably damaging Het
Trim23 A G 13: 104,181,018 probably benign Het
Tspear T C 10: 77,836,476 probably benign Het
Usp39 C A 6: 72,336,485 A241S probably benign Het
Vmn1r185 T A 7: 26,612,025 L18F possibly damaging Het
Zfp354c T A 11: 50,814,944 I435F probably damaging Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Other mutations in Zfp213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp213 APN 17 23561417 missense probably benign 0.18
IGL02302:Zfp213 APN 17 23557971 missense possibly damaging 0.88
ANU18:Zfp213 UTSW 17 23561417 missense probably benign 0.18
R2137:Zfp213 UTSW 17 23559507 synonymous probably null
R5149:Zfp213 UTSW 17 23561399 missense probably damaging 0.97
R5595:Zfp213 UTSW 17 23561186 missense possibly damaging 0.92
R5979:Zfp213 UTSW 17 23557911 nonsense probably null
R6227:Zfp213 UTSW 17 23558022 missense probably benign 0.16
R6711:Zfp213 UTSW 17 23559511 missense probably benign
R7105:Zfp213 UTSW 17 23558204 missense probably benign 0.40
R7409:Zfp213 UTSW 17 23559629 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGCCACATTCGGAACAGGAG -3'
(R):5'- CCCTTCTTGCAGGTTTGAGAC -3'

Sequencing Primer
(F):5'- TTCGGAACAGGAGAAGGGCTTC -3'
(R):5'- GCGACAGCATTGTTGGGAC -3'
Posted On2015-04-29