Incidental Mutation 'R4011:Ddx18'
ID311671
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission 040948-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R4011 (G1)
Quality Score162
Status Validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121562081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 200 (I200V)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably benign
Transcript: ENSMUST00000001724
AA Change: I200V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: I200V

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131471
Predicted Effect probably benign
Transcript: ENSMUST00000134417
SMART Domains Protein: ENSMUSP00000114149
Gene: ENSMUSG00000001674

DomainStartEndE-ValueType
Blast:DEXDc 2 47 2e-22 BLAST
HELICc 65 146 2.84e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148809
Meta Mutation Damage Score 0.1764 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,622,013 probably benign Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
C1qtnf1 G A 11: 118,446,539 G65D probably benign Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Cspg4 A G 9: 56,887,317 T779A probably benign Het
Dnah9 T A 11: 65,834,464 M4288L probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Gas1 T G 13: 60,175,977 D322A unknown Het
Gfm2 T A 13: 97,143,100 probably benign Het
Gm11487 T C 4: 73,401,810 Y244C probably damaging Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Hbb-bh2 T A 7: 103,840,209 H45L probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Igdcc4 T C 9: 65,135,479 V1237A probably benign Het
Kat2b G A 17: 53,644,741 probably null Het
Lmtk2 A G 5: 144,175,879 N1139S probably benign Het
Map1a G A 2: 121,300,127 A475T probably damaging Het
Map3k20 G A 2: 72,384,124 probably benign Het
Mga T C 2: 119,931,780 V1084A probably damaging Het
Myo3b A G 2: 70,096,376 I5V probably benign Het
Olfr110 T C 17: 37,499,491 V280A possibly damaging Het
Olfr1118 A G 2: 87,309,211 I141V probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr657 A G 7: 104,636,348 T225A probably benign Het
Osmr G T 15: 6,824,533 R565S probably benign Het
Pcolce G T 5: 137,605,774 Q344K probably benign Het
Prdm11 A G 2: 93,012,830 F95L probably damaging Het
Psd2 C T 18: 35,987,247 T383I probably benign Het
Reg3a G A 6: 78,383,570 D164N probably damaging Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sgce G T 6: 4,691,563 Y301* probably null Het
Slc28a3 T C 13: 58,566,250 K434E probably benign Het
Slc30a3 A G 5: 31,086,859 F360L probably damaging Het
Tdpoz3 A T 3: 93,826,243 Y75F possibly damaging Het
Trim65 A G 11: 116,127,703 F249L probably benign Het
Tubgcp3 A T 8: 12,639,634 L544* probably null Het
Vit C T 17: 78,534,692 probably benign Het
Wdfy4 C A 14: 33,102,680 probably benign Het
Xpo6 T C 7: 126,140,608 K431E probably benign Het
Xrn1 T A 9: 95,985,225 Y545* probably null Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGAACACAGGTGCCTAGCTC -3'
(R):5'- ATTCAGGCAGCCATGTGAC -3'

Sequencing Primer
(F):5'- GCTCCTAGCTCACAAAGACGG -3'
(R):5'- ATGTGACCACAGAGCTCTTG -3'
Posted On2015-04-29