Incidental Mutation 'R4011:Igdcc4'
ID311699
Institutional Source Beutler Lab
Gene Symbol Igdcc4
Ensembl Gene ENSMUSG00000032816
Gene Nameimmunoglobulin superfamily, DCC subclass, member 4
SynonymsWI-18508, WI-16786, Nope, 9330155G14Rik
MMRRC Submission 040948-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4011 (G1)
Quality Score119
Status Validated
Chromosome9
Chromosomal Location65101486-65137940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65135479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1237 (V1237A)
Ref Sequence ENSEMBL: ENSMUSP00000150272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035499] [ENSMUST00000077696] [ENSMUST00000166273] [ENSMUST00000213533]
Predicted Effect probably benign
Transcript: ENSMUST00000035499
AA Change: V1238A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045387
Gene: ENSMUSG00000032816
AA Change: V1238A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 318 1.13e-11 SMART
low complexity region 322 335 N/A INTRINSIC
IGc2 346 411 1.34e-13 SMART
FN3 428 511 3.58e-12 SMART
FN3 526 610 9.54e-8 SMART
FN3 630 726 7.34e-9 SMART
FN3 750 832 1.05e-9 SMART
FN3 848 932 2.14e-10 SMART
low complexity region 958 978 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1154 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077696
AA Change: V1284A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076878
Gene: ENSMUSG00000032816
AA Change: V1284A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 458 7.02e-8 SMART
FN3 475 558 3.58e-12 SMART
FN3 573 656 1.1e-7 SMART
FN3 676 772 7.34e-9 SMART
FN3 796 878 1.05e-9 SMART
FN3 894 978 2.14e-10 SMART
low complexity region 1004 1024 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
low complexity region 1200 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166273
AA Change: V226A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132576
Gene: ENSMUSG00000032816
AA Change: V226A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 40 83 3e-22 BLAST
low complexity region 142 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213533
AA Change: V1237A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,622,013 probably benign Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
C1qtnf1 G A 11: 118,446,539 G65D probably benign Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Cspg4 A G 9: 56,887,317 T779A probably benign Het
Ddx18 T C 1: 121,562,081 I200V probably benign Het
Dnah9 T A 11: 65,834,464 M4288L probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Gas1 T G 13: 60,175,977 D322A unknown Het
Gfm2 T A 13: 97,143,100 probably benign Het
Gm11487 T C 4: 73,401,810 Y244C probably damaging Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Hbb-bh2 T A 7: 103,840,209 H45L probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Kat2b G A 17: 53,644,741 probably null Het
Lmtk2 A G 5: 144,175,879 N1139S probably benign Het
Map1a G A 2: 121,300,127 A475T probably damaging Het
Map3k20 G A 2: 72,384,124 probably benign Het
Mga T C 2: 119,931,780 V1084A probably damaging Het
Myo3b A G 2: 70,096,376 I5V probably benign Het
Olfr110 T C 17: 37,499,491 V280A possibly damaging Het
Olfr1118 A G 2: 87,309,211 I141V probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr657 A G 7: 104,636,348 T225A probably benign Het
Osmr G T 15: 6,824,533 R565S probably benign Het
Pcolce G T 5: 137,605,774 Q344K probably benign Het
Prdm11 A G 2: 93,012,830 F95L probably damaging Het
Psd2 C T 18: 35,987,247 T383I probably benign Het
Reg3a G A 6: 78,383,570 D164N probably damaging Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sgce G T 6: 4,691,563 Y301* probably null Het
Slc28a3 T C 13: 58,566,250 K434E probably benign Het
Slc30a3 A G 5: 31,086,859 F360L probably damaging Het
Tdpoz3 A T 3: 93,826,243 Y75F possibly damaging Het
Trim65 A G 11: 116,127,703 F249L probably benign Het
Tubgcp3 A T 8: 12,639,634 L544* probably null Het
Vit C T 17: 78,534,692 probably benign Het
Wdfy4 C A 14: 33,102,680 probably benign Het
Xpo6 T C 7: 126,140,608 K431E probably benign Het
Xrn1 T A 9: 95,985,225 Y545* probably null Het
Other mutations in Igdcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Igdcc4 APN 9 65135164 missense probably damaging 1.00
IGL01285:Igdcc4 APN 9 65123991 missense probably damaging 1.00
IGL01412:Igdcc4 APN 9 65114449 splice site probably benign
IGL01485:Igdcc4 APN 9 65122607 missense probably benign 0.02
IGL01552:Igdcc4 APN 9 65122502 intron probably benign
IGL01651:Igdcc4 APN 9 65124112 missense possibly damaging 0.63
IGL01751:Igdcc4 APN 9 65131732 missense probably damaging 1.00
IGL02164:Igdcc4 APN 9 65124782 splice site probably benign
IGL02468:Igdcc4 APN 9 65126832 missense probably damaging 1.00
IGL02616:Igdcc4 APN 9 65133078 missense probably damaging 1.00
IGL02685:Igdcc4 APN 9 65133825 missense possibly damaging 0.81
IGL02734:Igdcc4 APN 9 65131456 missense possibly damaging 0.47
IGL02893:Igdcc4 APN 9 65133071 missense probably damaging 1.00
R0006:Igdcc4 UTSW 9 65135100 splice site probably benign
R0583:Igdcc4 UTSW 9 65121813 missense possibly damaging 0.85
R0939:Igdcc4 UTSW 9 65131473 critical splice donor site probably null
R1075:Igdcc4 UTSW 9 65131650 missense possibly damaging 0.90
R1110:Igdcc4 UTSW 9 65126926 missense possibly damaging 0.91
R1183:Igdcc4 UTSW 9 65121900 missense possibly damaging 0.91
R1318:Igdcc4 UTSW 9 65133690 missense probably damaging 1.00
R1507:Igdcc4 UTSW 9 65133744 missense probably damaging 1.00
R1548:Igdcc4 UTSW 9 65135227 missense probably benign 0.08
R1640:Igdcc4 UTSW 9 65122795 missense probably damaging 1.00
R1681:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R1687:Igdcc4 UTSW 9 65131663 missense probably damaging 1.00
R1716:Igdcc4 UTSW 9 65126897 missense probably damaging 1.00
R1964:Igdcc4 UTSW 9 65122769 missense probably benign
R1996:Igdcc4 UTSW 9 65121819 missense probably damaging 1.00
R2150:Igdcc4 UTSW 9 65125335 missense possibly damaging 0.92
R2278:Igdcc4 UTSW 9 65130743 missense probably damaging 1.00
R3085:Igdcc4 UTSW 9 65132058 missense probably damaging 1.00
R4077:Igdcc4 UTSW 9 65131765 missense probably damaging 1.00
R4191:Igdcc4 UTSW 9 65124151 missense probably benign 0.13
R4293:Igdcc4 UTSW 9 65124610 critical splice acceptor site probably null
R4589:Igdcc4 UTSW 9 65130628 missense probably damaging 1.00
R4931:Igdcc4 UTSW 9 65124015 missense possibly damaging 0.66
R5093:Igdcc4 UTSW 9 65122757 missense possibly damaging 0.51
R5106:Igdcc4 UTSW 9 65124701 missense probably damaging 1.00
R5546:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R5634:Igdcc4 UTSW 9 65134546 missense probably benign 0.18
R5810:Igdcc4 UTSW 9 65128695 missense probably damaging 1.00
R6395:Igdcc4 UTSW 9 65135118 missense probably damaging 1.00
R6475:Igdcc4 UTSW 9 65120321 missense probably damaging 1.00
R6776:Igdcc4 UTSW 9 65135418 missense probably benign 0.02
R6828:Igdcc4 UTSW 9 65122697 missense probably benign
R6914:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R6942:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R7072:Igdcc4 UTSW 9 65130731 missense probably damaging 1.00
R7234:Igdcc4 UTSW 9 65135468 nonsense probably null
R7448:Igdcc4 UTSW 9 65123994 missense possibly damaging 0.52
R7562:Igdcc4 UTSW 9 65124024 missense probably damaging 1.00
R7607:Igdcc4 UTSW 9 65133758 missense possibly damaging 0.85
R7734:Igdcc4 UTSW 9 65131753 missense probably damaging 0.99
R7807:Igdcc4 UTSW 9 65133795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTCAAGGAGCAGACTGG -3'
(R):5'- CAAGTCCCTCCTGTATGTGATGC -3'

Sequencing Primer
(F):5'- AGCAGACTGGCTGGGCAG -3'
(R):5'- CCCTCCTGTATGTGATGCAGAATATG -3'
Posted On2015-04-29