Incidental Mutation 'R0384:Klk1b21'
Institutional Source Beutler Lab
Gene Symbol Klk1b21
Ensembl Gene ENSMUSG00000066516
Gene Namekallikrein 1-related peptidase b21
SynonymsKlk21, mGk-21
MMRRC Submission 038590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0384 (G1)
Quality Score225
Status Validated
Chromosomal Location44102328-44106583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44105493 bp
Amino Acid Change Tyrosine to Histidine at position 71 (Y71H)
Ref Sequence ENSEMBL: ENSMUSP00000082582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085455]
Predicted Effect probably benign
Transcript: ENSMUST00000085455
AA Change: Y71H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082582
Gene: ENSMUSG00000066516
AA Change: Y71H

signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 9.09e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205984
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,986,812 probably benign Het
Akr1b8 T C 6: 34,364,330 probably benign Het
Arhgef39 A G 4: 43,498,613 L117P probably damaging Het
Atp13a1 A T 8: 69,797,324 Q356L possibly damaging Het
Bmp2k T A 5: 97,031,125 probably benign Het
Ccdc141 A G 2: 77,027,648 V1063A probably damaging Het
Col20a1 T C 2: 180,999,162 Y568H probably benign Het
Crabp2 T C 3: 87,953,021 V134A possibly damaging Het
Cyp19a1 T C 9: 54,172,741 K265E probably benign Het
Cyp2j9 T C 4: 96,585,885 H106R probably benign Het
Dcps T C 9: 35,175,943 K9R probably damaging Het
Dnajc6 C T 4: 101,598,956 T47I probably damaging Het
Dnhd1 T G 7: 105,720,114 S4315A possibly damaging Het
Dnmt3l A T 10: 78,052,737 I158F possibly damaging Het
Dock3 A G 9: 106,901,895 probably benign Het
Eefsec A G 6: 88,281,650 probably null Het
Fam204a T C 19: 60,221,296 M1V probably null Het
Fam98b T C 2: 117,267,847 V266A possibly damaging Het
Fat2 A T 11: 55,269,465 I3274N possibly damaging Het
Fbxo18 A G 2: 11,749,578 I198T probably damaging Het
Fer T C 17: 63,924,184 probably benign Het
Fhad1 T A 4: 142,002,426 M89L probably benign Het
Fjx1 C A 2: 102,451,107 C161F probably damaging Het
Fkbp7 T A 2: 76,665,824 probably benign Het
Gm42669 T A 5: 107,508,798 C976S probably benign Het
Gm4845 T C 1: 141,257,085 noncoding transcript Het
Herc1 T A 9: 66,481,050 probably benign Het
Hook3 C T 8: 26,044,235 probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Itga2b A T 11: 102,465,362 probably null Het
Kndc1 A T 7: 139,910,599 N339I possibly damaging Het
Ky C T 9: 102,542,090 T432I probably benign Het
Map4 C T 9: 110,034,628 T307I probably damaging Het
Matn1 T C 4: 130,944,476 L18P probably benign Het
Mindy4 G A 6: 55,216,684 D121N probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Msto1 G A 3: 88,910,339 Q441* probably null Het
Muc5ac A G 7: 141,812,251 H2048R possibly damaging Het
Musk T C 4: 58,373,711 *879Q probably null Het
Nat8f2 T C 6: 85,868,368 Y4C possibly damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Nid1 A G 13: 13,463,836 T114A probably benign Het
Npr1 C A 3: 90,465,167 G113C probably damaging Het
Nrxn1 G A 17: 90,208,347 P193S probably damaging Het
Nwd2 T C 5: 63,805,682 F870L probably benign Het
Olfr1076 T A 2: 86,509,383 I308K possibly damaging Het
Olfr1228 A G 2: 89,249,070 I208T possibly damaging Het
Olfr55 A G 17: 33,176,548 I45V probably damaging Het
Olfr787 T A 10: 129,463,040 Y121* probably null Het
Phf14 A G 6: 11,997,020 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm2 T C 4: 143,135,688 E344G probably benign Het
Psmd12 T C 11: 107,485,721 V61A probably benign Het
Relt T C 7: 100,847,505 D385G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scg2 T A 1: 79,435,549 I446F probably benign Het
Sema3b G A 9: 107,600,966 L407F probably damaging Het
Slc25a13 A T 6: 6,042,600 Y601* probably null Het
Sun5 C T 2: 153,858,965 V270I probably benign Het
Tex52 A G 6: 128,379,533 Y63C probably damaging Het
Tmem138 A G 19: 10,574,822 probably benign Het
Tnpo3 A G 6: 29,582,164 probably null Het
Tspoap1 A T 11: 87,766,454 Q364L probably damaging Het
Ttc41 T C 10: 86,763,947 L1037P probably damaging Het
Ugcg T A 4: 59,220,387 D393E possibly damaging Het
Vmn1r184 T C 7: 26,267,651 I274T probably benign Het
Vmn2r27 A G 6: 124,223,912 V362A probably benign Het
Vmn2r87 T A 10: 130,471,843 Y842F probably benign Het
Vps8 T A 16: 21,506,825 probably benign Het
Other mutations in Klk1b21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Klk1b21 APN 7 44105923 missense possibly damaging 0.81
IGL01710:Klk1b21 APN 7 44106495 missense probably benign 0.13
IGL02015:Klk1b21 APN 7 44104358 missense probably benign 0.41
R0138:Klk1b21 UTSW 7 44105895 missense probably damaging 1.00
R1456:Klk1b21 UTSW 7 44105499 missense probably benign 0.01
R2021:Klk1b21 UTSW 7 44105994 nonsense probably null
R2119:Klk1b21 UTSW 7 44105769 missense probably benign
R2265:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2267:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2269:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R5499:Klk1b21 UTSW 7 44105676 missense probably benign 0.07
R5623:Klk1b21 UTSW 7 44105565 missense probably damaging 0.98
R8151:Klk1b21 UTSW 7 44104363 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcctttctgtttctgtttgtttttc -3'
Posted On2013-04-24